What can your dog teach you about Genetics?

33 %
67 %
Information about What can your dog teach you about Genetics?
Education

Published on March 23, 2009

Author: richielearn

Source: slideshare.net

Description

Used in High Biology to reinforce concepts in Genetics. Use web site for pre and post work plus video.

http://sites.google.com/site/eleaningmodulesinbiology/

What can your Dog teach you about Molecular Genetics?

April 16 2009 Intended to supplement Genetics Class lectures Posted with additional information and ppt on website: http:// sites.google.com/site/eleaningmodulesinbiology / Material was assembled for a project for Harvard Extension “The Cognitive Dog” Class

Intended to supplement Genetics Class lectures

Posted with additional information and ppt on website:

http:// sites.google.com/site/eleaningmodulesinbiology /

Material was assembled for a project for Harvard Extension “The Cognitive Dog” Class

This is what I want you to know Why are geneticists interested in dogs? What is a QTL? What is the relationship between QTL’s and phenotypic change? Why is a SNP an effective Genetic Marker? Explain how a gene pool becomes bottlenecked. What is the effect of inbreeding on SNP differences between individual breeds? Why does both a pedigree family chart and genetic markers combine for a powerful tool for gene investigation?

Why are geneticists interested in dogs?

What is a QTL?

What is the relationship between QTL’s and phenotypic change?

Why is a SNP an effective Genetic Marker?

Explain how a gene pool becomes bottlenecked.

What is the effect of inbreeding on SNP differences between individual breeds?

Why does both a pedigree family chart and genetic markers combine for a powerful tool for gene investigation?

Why have dogs become very interesting to molecular geneticists?

Dogs on the cutting edge of genetic research Dog breeds represent a genetic bottleneck that decrease recombinant variability Genetic diseases are problematic with inbred dogs. ( At least 350 that are found in humans have been identified in different breeds) Many breeds have many generations of breeding documentation

Dog breeds represent a genetic bottleneck that decrease recombinant variability

Genetic diseases are problematic with inbred dogs. ( At least 350 that are found in humans have been identified in different breeds)

Many breeds have many generations of breeding documentation

Canine Genetic Screening Progressive Retinal Atrophy ( PRA ) Hypothyroidism with Goiter  ( HTG ) (Congenital Hypothyroidism) Cystinuria ( CYST ) Globoid Cell Leucodystrophy ( GCL ) Neuronal Ceroid Lipofuscinosis ( NCL ) Phosphofructosokinase Deficiency ( PFK ) Von Willebrand Disease ( vWD ) Narcolepsy ( NARC ) Cone degeneration ( CD ) Canine Leucocyte Adhesion Deficiency ( CLAD ) Hemophilia B ( HmB ) Muscular Dystrophy ( MD ) Myotonia Congenita ( MC ) GMI Gangliosidosis ( GMIG ) Retinal Dystrophy ( prad ) SCID ( DNA- PKc & DNA PKc2 ) Mucopolysaccharidosis Type VII ( GUSB_NOSVVIII ) Thrombasthenic Thrombopathia (  THROM) Congenital Cardiac Defects OFA Elbow & Hip Dysplasia

Progressive Retinal Atrophy ( PRA )

Hypothyroidism with Goiter  ( HTG ) (Congenital Hypothyroidism)

Cystinuria ( CYST )

Globoid Cell Leucodystrophy ( GCL )

Neuronal Ceroid Lipofuscinosis ( NCL )

Phosphofructosokinase Deficiency ( PFK )

Von Willebrand Disease ( vWD )

Narcolepsy ( NARC )

Cone degeneration ( CD )

Canine Leucocyte Adhesion Deficiency ( CLAD )

Hemophilia B ( HmB )

Muscular Dystrophy ( MD )

Myotonia Congenita ( MC )

GMI Gangliosidosis ( GMIG )

Retinal Dystrophy ( prad )

SCID ( DNA- PKc & DNA PKc2 )

Mucopolysaccharidosis Type VII ( GUSB_NOSVVIII )

Thrombasthenic Thrombopathia (  THROM)

Congenital Cardiac Defects

OFA Elbow & Hip Dysplasia

High quality map of Dog Genome Tasha the boxer 2005 map of her genome at the Broad Institute. Map of 2,400 million bases ATTTACGGATTACACGGAGG representing 18,846 genes http://www.biologycorner.com/bio1/DNA.html http://www.broad.mit.edu/media/2004/doggenome_0714.html

Tasha the boxer

2005 map of her genome at the Broad Institute.

Map of 2,400 million bases

ATTTACGGATTACACGGAGG

representing 18,846 genes

Quick Review of Genetic Terms and Principles Review of Genetics Terms and Principles

Review - Big Ideas in Genetics One gene – One phenotypic trait Recessive genes can hide under Dominant Dominant phenotype One phenotype – different genotypes! or BB Bb

Review - Big Ideas in Genetics * http://en.wikipedia.org/wiki/Qtl QTL – Quantitative Trait Loci 1908 Nilson-Ehle Many genes + environment One quantitative trait =

Review - Big Ideas in Genetics Single Nucleotide Polymorphism * http://en.wikipedia.org/wiki/Qtl Animation http://www.dnai.org/text/mediashowcase/index2.html?id=1083

only P1 and P4 have the DNA from grandparents G1 and G4 and thus, it is possible that the disease gene might be somewhere near ? . ~85% probability of finding a simple recessive trait. Review - Gene Markers for Beginners Now imagine that grandparents G1 and G4 and puppies P1 and P4 have the disease and we're looking at a recessive mode of inheritance. We would then look at the DNA markers we have and see that at position ?

Let’s go to the Movies Look for the following Perfect Population Bottleneck Regulatory Gene Describe the 3 sets of data necessary for this experimental design? http://watch.discoverychannel.ca/daily-planet/february-2009/daily-planet-february-26-2009/#clip144136

Look for the following

Perfect Population

Bottleneck

Regulatory Gene

Describe the 3 sets of data necessary for this experimental design?

Founders Effect Original Population Survivors are selected for breeding New Population

Population BottleNeck

Bottlenecked Gene Pool Wolf Dog AKC Breeds Wade “The Dog Genome:Sequence, Evolution, and Haplotype Structure” Broad Institute MIT

The Georgie Project Karl G Lark University of Utah Biology Depart Georgie 1986-1996

Karl G Lark University of Utah Biology Depart

Why is PWD population perfect for a genetics study? Inbreeding results in less recombination Less recombination results in fewer SNPs Fewer SNPS make it easier to identify genetic locations Documented phenotype of size, disease, hair, color in pedigree charts from breeders Easier to uncover loci for base sequences responsible for phenotype

Inbreeding results in less recombination

Less recombination results in fewer SNPs

Fewer SNPS make it easier to identify genetic locations

Documented phenotype of size, disease, hair, color in pedigree charts from breeders

Easier to uncover loci for base sequences responsible for phenotype

Documented PWD breeding lines Lark Web Site: Genetics of quantitative traits in Portuguese Water Dogs http://64.226.94.9/npwd.htm

Who’s your Daddy’s Daddy’s Daddy?

With high level of inbreeding all dog would look the same? Polymorphic

Genetic Resource Lark Web Site: Genetics of quantitative traits in Portuguese Water Dogs http://64.226.94.9/npwd.htm

Zero Correlation Pedigree Markers

Is there a correlation between genetic markers in PWD and breeding lineage? Lark Web Site: Genetics of quantitative traits in Portuguese Water Dogs http://64.226.94.9/npwd.htm

Results - QTL linking the skull, legs ,hip Courtesy Sanger Inst http://www.georgieproject.com/x-ray/x-ray.htm

Results - QTL Size IGF1 Chrom 15 http:// www.ncbi.nlm.nih.gov/mapview/map_search.cgi?taxid =9615&build= current&advsrch = off&query =igf1

Elegance of the Georgie experiment Free living population of animals versus a colony of laboratory dogs that are inbred.

Georgie and my dog Are there similar DNA sequences in my dog that will make him susceptible to autoimmune disease? Georgie McGyver

If you can find a population

If you can build a database of BioMarkers

Biomarker Research Protein Identification Protein Digest Sample Handling Data Analysis Peptide Separation Data Storage Cells or Tissue Thermo Scientific Laboratory Workflow Sample Preparation Data Interpretation & Storage Sample Analysis Robotics Centrifuges Concentrators Liquid Chromatography/Mass Spectrometry Lab Information Management System Microplate Readers Software Xcalibur Protein Fractionation Freezers Biomarker Identified

You can crack the code of life’s form and function Genetic regulation of osteoarthritis: A QTL regulating cranial and caudal acetabular osteophyte formation in the hip joint of the dog (Canis familiaris). Amer. J. Med. Genet. 135A(3):334-335. http://www3.interscience.wiley.com/cgi-bin/jtoc/33129/ Carrier DR, Chase K, Lark KG. Genetics of canid skeletal variation: size and shape of the pelvis. Genome Res. 2005 Dec;15(12):1825-30. PMID: 16339381 [PubMed - indexed for MEDLINE] Chase K, Carrier DR, Adler FR, Ostrander EA, Lark KG . Interaction between the X chromosome and an autosome regulates size sexual dimorphism in Portuguese Water Dogs. Genome Res. 2005 Dec;15(12):1820-4. PMID: 16339380 [PubMed - indexed for MEDLINE] Lark, K.G., Chase, K., Carrier, D.R. and F.R. Adler (2005)

Genetic regulation of osteoarthritis: A QTL regulating cranial and caudal acetabular osteophyte formation in the hip joint of the dog (Canis familiaris). Amer. J. Med. Genet. 135A(3):334-335. http://www3.interscience.wiley.com/cgi-bin/jtoc/33129/ Carrier DR, Chase K, Lark KG.

Genetics of canid skeletal variation: size and shape of the pelvis. Genome Res. 2005 Dec;15(12):1825-30. PMID: 16339381 [PubMed - indexed for MEDLINE] Chase K, Carrier DR, Adler FR, Ostrander EA, Lark KG .

Interaction between the X chromosome and an autosome regulates size sexual dimorphism in Portuguese Water Dogs. Genome Res. 2005 Dec;15(12):1820-4. PMID: 16339380 [PubMed - indexed for MEDLINE] Lark, K.G., Chase, K., Carrier, D.R. and F.R. Adler (2005)

Wealth of research Genetic analysis of the canid skeleton: Analysis of morphological loci (QTLs) in the Portuguese Water Dog population. In: "The Genome of the Domestic Dog" (Cold Spring Harbor Monograph Series 44). pp. 67-80. Editors: E.A. Ostrander, U. Giger, and K. Lindblad-Toh. Cold Spring Harbor Press, Cold Spring Harbor, NY. Trut, L.N., Kharlamova, A.V., Carrier, D.R., Chase, K., Kukekova, A.V., Acland, G.M. and K.G. Lark (2005) Morphology and behavior: Are they coupled at the genome level? In: "The Genome of the Domestic Dog² (Cold Spring Harbor Monograph Series 44). pp. 81-93. Editors: E.A. Ostrander, U. Giger, and K. Lindblad-Toh. Cold Spring Harbor Press, Cold Spring Harbor, NY. Lark KG, Chase K, Sutter NB . Genetic architecture of the dog: sexual size dimorphism and functional morphology. Trends Genet. 2006 Oct;22(10):537-44. Epub 2006 Aug 24 PMID: 16934357 [PubMed - in process

Genetic analysis of the canid skeleton: Analysis of morphological loci (QTLs) in the Portuguese Water Dog population. In: "The Genome of the Domestic Dog" (Cold Spring Harbor Monograph Series 44). pp. 67-80. Editors: E.A. Ostrander, U. Giger, and K. Lindblad-Toh. Cold Spring Harbor Press, Cold Spring Harbor, NY. Trut, L.N., Kharlamova, A.V., Carrier, D.R., Chase, K., Kukekova, A.V., Acland, G.M. and K.G. Lark (2005)

Morphology and behavior: Are they coupled at the genome level? In: "The Genome of the Domestic Dog² (Cold Spring Harbor Monograph Series 44). pp. 81-93. Editors: E.A. Ostrander, U. Giger, and K. Lindblad-Toh. Cold Spring Harbor Press, Cold Spring Harbor, NY. Lark KG, Chase K, Sutter NB .

Genetic architecture of the dog: sexual size dimorphism and functional morphology. Trends Genet. 2006 Oct;22(10):537-44. Epub 2006 Aug 24 PMID: 16934357 [PubMed - in process

Wealth of research Chase K, Lawler DF, Adler FR, Ostrander EA, Lark KG. Bilaterally asymmetric effects of quantitative trait loci (QTLs): QTLs that affect laxity in the right versus left coxofemoral (hip) joints of the dog (Canis familiaris). Am J Med Genet A. 2004 Jan 30;124(3):239-47. PMID: 14708095 [PubMed - indexed for MEDLINE] Chase K, Carrier DR, Adler FR, Jarvik T, Ostrander EA, Lorentzen TD, Lark KG. Inherited infantile dilated cardiomyopathy in dogs: genetic, clinical, biochemical, and morphologic findings. Am J Med Genet. 2000 Nov 6;95(1):57-66. PMID: 11074496 [PubMed - indexed for MEDLINE] Chase K, Adler FR, Miller-Stebbings K, Lark KG. Teaching a new dog old tricks: identifying quantitative trait loci using lessons from plants. J Hered. 1999 Jan-Feb;90(1):43-51. PMID: 9987902 [PubMed - indexed for MEDLINE]

Chase K, Lawler DF, Adler FR, Ostrander EA, Lark KG. Bilaterally asymmetric effects of quantitative trait loci (QTLs): QTLs that affect laxity in the right versus left coxofemoral (hip) joints of the dog (Canis familiaris). Am J Med Genet A. 2004 Jan 30;124(3):239-47. PMID: 14708095 [PubMed - indexed for MEDLINE] Chase K, Carrier DR, Adler FR, Jarvik T, Ostrander EA, Lorentzen TD, Lark KG.

Inherited infantile dilated cardiomyopathy in dogs: genetic, clinical, biochemical, and morphologic findings. Am J Med Genet. 2000 Nov 6;95(1):57-66. PMID: 11074496 [PubMed - indexed for MEDLINE] Chase K, Adler FR, Miller-Stebbings K, Lark KG.

Teaching a new dog old tricks: identifying quantitative trait loci using lessons from plants. J Hered. 1999 Jan-Feb;90(1):43-51. PMID: 9987902 [PubMed - indexed for MEDLINE]

Add a comment

Related presentations

Related pages

What can your dog teach you about Molecular Genetics ...

What can your dog teach you about Molecular Genetics? ... ← Basics of Genetics: a Royal Canin presentation “Wicked problems”: ...
Read more

What Wolves Can Teach You About Your Dog - jnhsgjg.com

Get Instant Access to free Read PDF What Wolves Can Teach You About Your Dog at Our Ebooks Unlimited Database. ... Genetics Comparing Mitosis And Meiosis ...
Read more

Teach.Genetics

Welcome to the new Teach.Genetics Here you'll find ... Teach.Genetics offers additional tools and resources to support your ... Teach.Genetics is ...
Read more

A Recipe for Traits Print-and-Go - Teach.Genetics

... http://teach.genetics.utah.edu ... map” of your dog genome. ... for each of the traits listed on the Dog Traits Key. A Recipe for Traits ...
Read more

Meiotic Gene Evolution: Can You Teach a New Dog New Tricks?

... Can You Teach a New Dog New Tricks? ... Looking for your next opportunity? ... Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, ...
Read more

What You Need To Know To Teach Genetics - gripnripit.com

Download Instant Access To What You Need To Know To Teach Genetics PDF Ebook WHAT YOU ... your readings everyday. Download : What You ... your dog, over a ...
Read more

Dogs Dont Bite When A Growl Will Do What Your Dog Can ...

do what your dog can teach you about living a happy life is universally compatible with ... Encyclopaedia Of Genetics [PDF] The Near Earth Asteroid ...
Read more

Breeding - Dog Coat Colour Genetics

The example above is one used by countless websites and articles on dog genetics, ... Working out the breeding genetics of ... You can find more ...
Read more

Genetics Teach Yourself Educational S - don.pdcjournal.com

Download and Read Genetics Teach Yourself ... educational and fun games to teach your dog to enjoy working with you PDF ... what they can teach us ...
Read more