
Virology Journal Club

67 %
33 %
Information about Virology Journal Club
Health & Medicine

Published on February 21, 2009

Author: Prenesh



Journal club
HIV and stem cell transplant



Virology Journal Club 18 February 2009 Preneshni R Naicker


Introduction HIV-1 enters host cells by binding to a CD4 receptor and then interacting with either CCR5 or CXCR4.

HIV-1 enters host cells by binding to a CD4 receptor and then interacting with either CCR5 or CXCR4.

Homozygosity for a 32-bp deletion (delta32/delta32) in the CCR5 allele  inactive CCR5 gene product  high resistance against HIV-1 acquisition

Homozygosity for a 32-bp deletion (delta32/delta32) in the CCR5 allele  inactive CCR5 gene product  high resistance against HIV-1 acquisition

Allogeneic stem-cell transplantation from an HLA-matched donor is a feasible option for pts with hematologic neoplasms. It is not established as a therapeutic option for pts also infected with HIV. The outcome of allogeneic stem-cell transplantation in a pt with HIV infection and AML Using a transplant from an HLA-matched, unrelated donor who was screened for homozygosity for CCR5 delta32 deletion.

Allogeneic stem-cell transplantation from an HLA-matched donor is a feasible option for pts with hematologic neoplasms.

It is not established as a therapeutic option for pts also infected with HIV.

The outcome of allogeneic stem-cell transplantation in a pt with HIV infection and AML

Using a transplant from an HLA-matched, unrelated donor who was screened for homozygosity for CCR5 delta32 deletion.

Case report 40 year old Caucasian man Presented with newly diagnosed AML (FAB M4 sub-type, with normal cytogenetic features) Diagnosed with HIV 10 years ago Treated with HAART Efavirenz 600mg daily Emtricitabine 200mg daily Tenofovir 300mg daily

40 year old

Caucasian man

Presented with newly diagnosed AML (FAB M4 sub-type, with normal cytogenetic features)

Diagnosed with HIV 10 years ago

Treated with HAART

Efavirenz 600mg daily

Emtricitabine 200mg daily

Tenofovir 300mg daily

Case report cont.. On HAART for 4 years No AIDS-associated illness observed. When AML diagnosed CD4 = 415 VL = undetectable Treatment of AML 2 x induction chemotherapy 1 x consolidation chemotherapy

On HAART for 4 years

No AIDS-associated illness observed.

When AML diagnosed

CD4 = 415

VL = undetectable

Treatment of AML

2 x induction chemotherapy

1 x consolidation chemotherapy

Case report cont… During the 1 st induction course, severe hepatic toxicity developed and renal failure occurred. HAART discontinued Viral rebound VL = 6.9x10 6 copies/ml HAART resumed 3 months later VL = undetectable 7 months after presentation AML relapse

During the 1 st induction course, severe hepatic toxicity developed and renal failure occurred.

HAART discontinued

Viral rebound VL = 6.9x10 6 copies/ml

HAART resumed

3 months later VL = undetectable

7 months after presentation AML relapse

Case report cont.. Allogeneic stem-cell transplantation CD43+ peripheral-blood stem cells from an HLA-identical donor who had been screened for homozygosity for CCR5 delta32 allele. Informed consent Approved by institutional review board

Allogeneic stem-cell transplantation

CD43+ peripheral-blood stem cells from an HLA-identical donor who had been screened for homozygosity for CCR5 delta32 allele.

Informed consent

Approved by institutional review board

Case report cont… HLA genotyped identical at the following loci: A*0201;B*0702,3501;Cw0401,0702;DRB1*0101.1501 and DQB1*0501,0602 Patient received a graft containing 2.3x10 6 CD34+ cells/kg

HLA genotyped identical at the following loci:

A*0201;B*0702,3501;Cw0401,0702;DRB1*0101.1501 and DQB1*0501,0602

Patient received a graft containing 2.3x10 6 CD34+ cells/kg

Case report cont… Other medication Rabbit antithymocyte globulin Cyclosporine Mycophenolate mofetil HAART administered until the day before Engraftment achieved 13 days later Grade I graft-versus-host disease of skin – cyclosporine adjusted

Other medication

Rabbit antithymocyte globulin


Mycophenolate mofetil

HAART administered until the day before

Engraftment achieved 13 days later

Grade I graft-versus-host disease of skin – cyclosporine adjusted

Case report cont… AML relapse 332 days post-transplantation Chimerism decreased to 15% Reinduction with cytarabine and gemtuzumab Single dose of whole body irradiation (200cGy) DAY 391  2 nd transplant of 2.1x10 6 CD34+ cells/kg from the same donor Complete remission of AML at 20 months

AML relapse 332 days post-transplantation

Chimerism decreased to 15%

Reinduction with cytarabine and gemtuzumab

Single dose of whole body irradiation (200cGy)

DAY 391  2 nd transplant of 2.1x10 6 CD34+ cells/kg from the same donor

Complete remission of AML at 20 months


Methods  CCR5 genotyping DNA extraction: QIAamp Blood Midi Kit (Qiagen) from peripheral-blood monocytes Screening donor for CCR5 delta32 allele with PCR. Fwd: 5’CTCCCAGGAATCATCTTTACC3’ Rev:5’TCATTTCGACACCGAAGCAGC3’ 200bp CCR5 allele 168bp delta32 deletion

 CCR5 genotyping

DNA extraction: QIAamp Blood Midi Kit (Qiagen) from peripheral-blood monocytes

Screening donor for CCR5 delta32 allele with PCR.



200bp CCR5 allele 168bp delta32 deletion

Methods cont.. Results confirmed by allele-specific PCR and direct sequencing (BigDye Terminator v1.1 Cycle Sequencing) Sequences analyzed with Vector NTI ContigExpress software (Invitrogen) Viral Envelope Genotyping Coreceptor use by HIV-1 assessed through V3 aa sequences of env region

Results confirmed by allele-specific PCR and direct sequencing

(BigDye Terminator v1.1 Cycle Sequencing)

Sequences analyzed with Vector NTI ContigExpress software (Invitrogen)

Viral Envelope Genotyping

Coreceptor use by HIV-1 assessed through V3 aa sequences of env region

Methods cont.. Direct sequencing of bulk PCR products RNA- env region sequenced An ultradeep PCR analysis with parallel sequencing was performed

Direct sequencing of bulk PCR products

RNA- env region sequenced

An ultradeep PCR analysis with parallel sequencing was performed

Methods cont…  Chemokine receptors & surface antigens Mucosal cells isolated from 10 rectal biopsy specimens CCR5 expression simulated by phytohemagglutinin (Sigma) Cells analysed by flow cytometry

 Chemokine receptors & surface antigens

Mucosal cells isolated from 10 rectal biopsy specimens

CCR5 expression simulated by phytohemagglutinin (Sigma)

Cells analysed by flow cytometry

Methods cont..  Chimerism Based on discrimination bet donor & recipient alleles on short tandem repeats. Used PCR and fluorescence-labeled primers

 Chimerism

Based on discrimination bet donor & recipient alleles on short tandem repeats.

Used PCR and fluorescence-labeled primers

Methods cont…  Cellular & humoral immune response Secretion of INF- γ by Ag-specific cells was induced. T cell mediated immune response was measured for HIV-1 and CMV. Antibodies against HIV-1 determined with an enzyme-linked immunoassay and immunoblot assay

 Cellular & humoral immune response

Secretion of INF- γ by Ag-specific cells was induced.

T cell mediated immune response was measured for HIV-1 and CMV.

Antibodies against HIV-1 determined with an enzyme-linked immunoassay and immunoblot assay

Methods cont…  Amplification of HIV-1 DNA & RNA HIV-1 RNA amplified using Cobas AmpliPrep-TaqMan HIV assay (Roche) Total DNA isolated from peripheral blood monocytes and rectal biopsy specimens env and LTR regions were amplified

 Amplification of HIV-1 DNA & RNA

HIV-1 RNA amplified using Cobas AmpliPrep-TaqMan HIV assay (Roche)

Total DNA isolated from peripheral blood monocytes and rectal biopsy specimens

env and LTR regions were amplified

Results  Distribution of CCR5 alleles Genomic DNA from 62 of 80 potential HLA-identical stem-cell donors was sequenced in the CCR5 region Only 1 donor homozygous for CCR5 delta32 deletion

 Distribution of CCR5 alleles

Genomic DNA from 62 of 80 potential HLA-identical stem-cell donors was sequenced in the CCR5 region

Only 1 donor homozygous for CCR5 delta32 deletion

Results cont…  HIV-1 coreceptor phenotype Sequence analysis revealed glycine at 11 and glutamic acid at 25 of V3 region Net charge of aa was +3 => CCR5 coreceptor use by the infecting strain This was confirmed by sequencing RNA in env region Ultradeep R: 2.9% X4 and dual-tropic variants

 HIV-1 coreceptor phenotype

Sequence analysis revealed glycine at 11 and glutamic acid at 25 of V3 region

Net charge of aa was +3

=> CCR5 coreceptor use by the infecting strain

This was confirmed by sequencing RNA in env region

Ultradeep R: 2.9% X4 and dual-tropic variants

Results cont..  Recipient chimerism

 Recipient chimerism

Results cont… Cellular and humoral immune response

Cellular and humoral immune response

Results cont…

Results cont…  Quantification of viraemia HIV-1 RNA remained undetectable No proviral DNA (except D20 – env , LTR/ D61 – env )  Rectal-biopsy specimens D159 = macrophages showed expression of CCR5 – not present in mucosal CD4+ T lymphocytes

 Quantification of viraemia

HIV-1 RNA remained undetectable

No proviral DNA

(except D20 – env , LTR/ D61 – env )

 Rectal-biopsy specimens

D159 = macrophages showed expression of CCR5 – not present in mucosal CD4+ T lymphocytes

Discussion Successful transplantation of allogeneic stem cells homologous for CCR5 delta32 allele to a pt with HIV Pt had X4 variants before the SCT Discontinued HAART >20 months but HIV-1 could not be detected The persistence of HIV-1 populations can be observed without viraemia CCR5 macrophages still present

Successful transplantation of allogeneic stem cells homologous for CCR5 delta32 allele to a pt with HIV

Pt had X4 variants before the SCT

Discontinued HAART >20 months but HIV-1 could not be detected

The persistence of HIV-1 populations can be observed without viraemia

CCR5 macrophages still present

Discussion cont… X4 variants may be source for re-emerging viruses Ab against env due to long-lived plasma cells resistant to immunosupp therapy Does not require HAART if VL undetectable Highlights the role of CCR5 receptor Further investigations encouraged

X4 variants may be source for re-emerging viruses

Ab against env due to long-lived plasma cells resistant to immunosupp therapy

Does not require HAART if VL undetectable

Highlights the role of CCR5 receptor

Further investigations encouraged

Thank you

Add a comment

Related presentations

Related pages

Journal of Virology

Journal of Virology (JVI) explores the nature of the viruses of animals, archaea, bacteria, fungi, plants, and protozoa. We welcome papers on ...
Read more

Cornell University :: Program in Virology :: Journal Club

The Virology Journal Club is a series of virology research colloquia given by students and faculty from across the University. To join the virology ...
Read more

Cornell University :: Program in Virology :: Journal Club

The Virology Journal Club is a series of virology research colloquia given by students and faculty from across the University. Journal Club meets ...
Read more

LSU Virology Journal Club 120614 | Facebook

At Louisiana State University Microbiology & Immunology LSU Health Sciences Center Shreveport, we have a weekly Virology Journal Club. Dr. Eiichiro Kawai ...
Read more

VirologyJournalClub - LSUHSC

Virology Journal Club . 2015 Schedule . FRIDAY, NOON . Room 6-329 : October 7 October 14 October 21 October 28 November 4 November 11 November 18 ...
Read more

Education – Center for Virus Research

Education & Training. Virology Training Program. Previous Trainees; Learn More; ... The virology journal club is held every week during the Spring quarter.
Read more

Journal Club Spring 200 5 - University of Maryland College ...

Virology Graduate Training Program at the University of Maryland. JOURNAL CLUB . Journal Club Spring 2005. Replication and Translation of ...
Read more


2/15/2016 IMMUNOLOGY JOURNAL CLUB SCHEDULE 2015-2016 FALL 2015 DATE NAME October 5 October 12 Nick Parekh October 19 October 26 Sathi Chodisetti
Read more

How to Prepare an Outstanding Journal Club Presentation

Journal club presentations provide a forum through which hematology trainees keep abreast of new developments in hematology and engage in informal ...
Read more

umd-virology-program -

umd-virology-program -
Read more