
Use of 2T TA PCR in HPV16 diagnostic model

0 %
100 %
Information about Use of 2T TA PCR in HPV16 diagnostic model

Published on February 7, 2008

Author: Siro



Slide1:  Use of 2T-TA PCR in HPV-16 diagnostic model Slide2:  Experiment in HPV-16 model to establish: Effect of extended primers and initial high temperature cycling on sensitivity of standard reaction Detection capabilities of 2T-TA Experimental outline: 1. Amplification of amplicon / target with standard & 2T-TA primers 2. Detection of target in genomic DNA background 3. Detection of amplicon in genomic DNA background 4. Detection of amplicon & target in genomic DNA background HPV-16 2T-TA: outline HPV-16 2T-TA: background:  HPV-16 2T-TA: background Standard F primer: ATGAAATAGATGGTCCA Standard R primer: GCAACAAAAGGTTACAA 2T-TA F primer: GCACGCCGAGAGAAGAGACATGAAATAGATGGTCCA 2T-TA R primer: GCACGTCCGCTGTGACTGTCGCAACAAAAGGTTACAA HPV16 target DNA mimic (92bp): AGCTCAGAGGAGGAGGATGAAATAGATGGTCCAGCTGGACAAGCAGAACCGGACAGAGC CCATTACAATATTGTAACCTTTTGTTGCAAGTG Human genomic DNA 50ng/ml (Promega Corporation) LightCycler 1.2 (Roche Applied Sciences) FastStart SYBR Green I Master Mix (Roche Applied Sciences) HPV-16 2T-TA: PCR product Tm and size:  HPV-16 2T-TA: PCR product Tm and size 2T-TA primer product Standard primer product 34bp 67bp 110bp Standard product 2T-TA product Size marker 5% agarose gel Expected sizes of PCR products: Standard primers 71bp 2T-TA primers 110bp HPV-16 2T-TA :Amplification of target and amplicon DNA with standard and 2T-TA primers:  HPV-16 2T-TA :Amplification of target and amplicon DNA with standard and 2T-TA primers HPV-16 2T-TA: Detection of amplicon with 2T-TA primers and 72°C annealing:  HPV-16 2T-TA: Detection of amplicon with 2T-TA primers and 72°C annealing Dilution series: 108 to 102 copies amplicon DNA NTC 95°C 10 min x 1 95°C 10 sec 72°C 20 sec x40 Cycling parameters: HPV-16 2T-TA: Detection of HPV-16 target DNA in background of human genomic DNA:  HPV-16 2T-TA: Detection of HPV-16 target DNA in background of human genomic DNA Increased efficiency with extended primers HPV-16 2T-TA: Detection of amplicon in background of human genomic DNA:  HPV-16 2T-TA: Detection of amplicon in background of human genomic DNA NTC Dilution series: 105 to 101 copies amplicon DNA 95°C 10 min x 1 95°C 10 sec 70°C 0 sec x40 77°C 25sec Cycling parameters: HPV-16 2T-TA: Detection of single copy amplicon:  HPV-16 2T-TA: Detection of single copy amplicon 95°C 10 min x 1 95°C 10 sec 70°C 0 sec x45 77°C 25sec 95 °C 10 sec 47°C 0 sec x40 77°C 25sec Cycling parameters: 70°C annealing 47°C annealing Amplicon only 103 102 101 100 100 amplicon only No amplification was seen at dilution of 10-1 copies amplicon DNA Fraction of 100 amplicon samples detected to contain amplicon was consistent with distribution of single copies. Conclusion is that 2T-TA method detected single copy amplicon HPV-16 2T-TA: Detection of amplicon in the presence of target DNA:  HPV-16 2T-TA: Detection of amplicon in the presence of target DNA 95°C 10 min x 1 95°C 10 sec 70°C 0 sec x45 77°C 25sec 95 °C 10 sec 47°C 0 sec x40 77°C 25sec Cycling parameters: 70°C annealing 47°C annealing Amplicon Target 103 106 102 106 101 106 106 target only HPV-16 2T-TA: Detection of amplicon in mixtures of amplicon and target :  HPV-16 2T-TA: Detection of amplicon in mixtures of amplicon and target 95°C 10 min x 1 95°C 10 sec 70°C 0 sec x45 77°C 25sec 95 °C 10 sec 47°C 0 sec x40 77°C 25sec Cycling parameters: Crossing points are the same for varying levels of target Detection of single copy amplicon HPV-16 2T-TA: Crossing point for detection of target is not altered by initial high temperature cycles :  HPV-16 2T-TA: Crossing point for detection of target is not altered by initial high temperature cycles HPV-16 2T-TA: Summary:  HPV-16 2T-TA: Summary 2T-TA PCR can detect single copy of amplicon DNA in background of human genomic DNA Crossing point for target DNA was not affected by high temperature cycles in 2T-TA PCR, suggesting optimised 2T-TA PCR will have equivalent sensitivity to standard PCR Experiment needs to be repeated in the context of further optimised clinical diagnostic model Slide14:  Magdalen Centre The Oxford Science Park Oxford SX4 4GA direct dial: +44 (0) 7771 802713

Add a comment

Related presentations

Related pages

Polymerase chain reaction - Wikipedia, the free encyclopedia

The polymerase chain reaction (PCR) ... The vast majority of PCR methods use ... and animal models. The basis for PCR diagnostic applications in ...
Read more

Recent Advances in HPV Testing

Recent Advances in HPV Testing ... Recommendations for HPV16/18 ... • The Roche Diagnostics AMPLICOR HPV Test • PCR to target and amplify HPV DNA from ...
Read more

A Humanized Mouse Model of HPV-Associated Pathology Driven ...

Our findings validate the use of this model for ... HPV5 and HPV16 were obtained by PCR using ... a basis for selection of diagnostic ...
Read more

Role of HPV in Urothelial Carcinogenesis: Current State of ...

early diagnostic markers for this cancer type. ... use of certain medicines; ... HPV16 and HPV18 using PCR.
Read more

Enhanced specificity of HPV16 E6E7 siRNA by RNA–DNA ...

... (PCR) method with ... (Roche Diagnostics, ... we found that dsRDC modification enhanced the specificity of HPV16 E6E7 siRNA by reducing its nonspecific ...
Read more

Bio-Rad | Products for Life Science Research & Clinical ...

Life Science Research. Products. PCR Amplification; ... PCR Amplification Kits ; Model Organism Kits; ... Life Science Research; Clinical Diagnostics;
Read more

A comparison of clinically utilized human papillomavirus ...

A comparison of clinically utilized human papillomavirus detection methods in head and neck cancer
Read more

Sequential cisplatin therapy and vaccination with HPV16 ...

PCR & Amplification; RNAi, CRISPR, ZFNs; Synthetic Biology; ... Diagnostic Manufacturing; Energy & Display; Environmental & IH; Flavors & Fragrances; Food ...
Read more