SSR marker organisation in tritiaceae

50 %
50 %
Information about SSR marker organisation in tritiaceae
Entertainment

Published on February 18, 2014

Author: ckcr

Source: authorstream.com

Slide 2: Presentation on “Physical organisation of SSR in Triticeae: structural, functional and evolutionary implications” Presented By: Chethana, C. K. PG12AGR5692 Dept. of Genetics and Plant Breeding. College of Agriculture, Dharwad contents : Introduction Marker : Definition, types, DNA Markers : Definition, types, Ideal properties. Microsatellite marker : existence, abundance in genome Types of SSR markers Microsatellite markers in wheat : application Improving SSR detection using synthetic probes Presence and distribution of SSR in wheat, rye and barley SSR in heterochromatic regions of higher eukaryotes Synthetic SSR as landmarks for chromosome identification Are SSR involves a chromosome function ? Advantages and Disadvantages conclusion 3 contents Slide 4: INTRODUCTION What are markers? : What are markers? Any trait of an organism or plant that can be identify with confidence and relative ease. or Any character of an organism or plants which can be easily identified referred as marker character. Slide 6: A marker should inherit in a codominant fashion. A marker should be selectively neutral in behavior. A marker should be abundant, frequently occurring and randomly distributed throughout the genome. Should show phenotypic neutrality. it should have no deleterious effect on the plants phenotype. Easy accessibility. A marker should have an easy and fast assay with high reproducibility, so that the process could be automated. A marker should facilitate easy exchange of data between laboratories. CONT.. Types of molecular or DNA markers : Types of molecular or DNA markers Molecular markers can be classified into different groups based on. Based on Mode of gene action: 1.Dominant markers. eg. RAPD, AFLP, ISSR 2.Codominant Markers. eg. RFLP, SSR. Based on analysis. 1.Hybridisation based eg. RFLP, VNTR 2.PCR based markers eg. RAPD, AFLP, SSR. SNP Microsatellite markers : Microsatellite markers Are stretches of DNA sequence consisting of short tandem repeats of mono-, di-, tri-, tetra-, penta- and hexa-nucleotides Microsatellite are tandemly repeated motif of 1-6 nucleotides. Dinucleotide (CT)6 - CTCTCTCTCTCT Trinucleotide (CTG)4 - CTGCTGCTGCTG Tetranucleotide (ACTC)4 - ACTCACTCACTCACTC Microsatellites markers also known as Simple Sequence Repeats (SSRs), short tandem repeats (STRs) or simple sequence length polymorphisms(SSLPs). Chambers and MacAvoy (2000) suggested following a strict definition of 2–6 bp Repeats. Mc Donald and Potts., 1997 Slide 9: widely distributed throughout genomes found in all prokaryotic and eukaryotic genomes One common example of a microsatellite is a dinucleotide repeat (CA)n. CA nucleotide repeats are very frequent in human and other genomes, and present every few thousand base pairs. These repeats are present in both coding and non-coding regions (Hancock 1995) and are usually characterized by a high degree of length polymorphism (Zane et al.2002). Contd., Slide 10: Where are microsatellites found? Majority are in non-coding region Abundance in genome : Abundance in genome Plant genomes contain on average 10 times less microsatellites than the human genome In plants (AT)n, (GA)n, (GAA)n, (TAA)n are the most common types of di- and tri-nucleotide repeats respectively, (CA)n is relatively rare in plants but very frequent in animals. Why do microsatellite exist? : Why do microsatellite exist? Majority are found in non-coding regions; and also known to occur coding region of genome also. Highly variable sequences, occur ubiquitously, dispersed in large numbers throughout all eukaryotic and some prokaryotic genomes In plant, high density of SSRs were found in close proximity to coding regions; regulatory properties High level of polymorphism; a necessary source of genetic variation Slide 13:  Gel configuration SSR POLYMORPHISM Types of SSR : Types of SSR Mononucleotide SSRs- (A)n, (T)n, (C)n, (G) Dinucleotide SSR - (AT)n, (CG)n, (GT)n Trinucleotide SSRs - (ATT)n, (CCG)n, (GTA)n Tetranucleotide SSRs - (CCGG)n, (TATC)n Slide 15: Perfect SSR The repeat sequence is not interrupted by any base not belonging to the motif. when repeat tract pure for one motif. Imperfect SSR There is a pair of bases between the repeated motifs that does not match the motif sequence. if single base substitution AAAAAAAAAAAA - (A)12 ATATATATATATATATAT - (AT)9 CCGCCGCCGCCGCCGCCG - (CCG)7 AAAAATAAAAAAAA ATATATATACATATATAT CTCTCTACTCTCT Slide 16: Compound SSR: The sequence contains two adjacent distinctive sequence-repeats. when repeat tract pure for two motifs. ATATATATCACACAATATATATCACACA - (AT)4(CA)3 CCGCCGATATATATCCGCCGATATATAT - (CCG)3(AT)4 Interrupted SSR: There is a small sequence within the repeated that does not match the motif sequence. TATATACGTGTATATATATA Mutation Mechanisms: : Mutation Mechanisms: Due to their high mutability, SSRs play a significant role as molecular markers for evolutionary and population genetic studies. mutation rate of microsatellites is much higher than that of other parts of the genome, ranging from 10-2 to 10-6 nucleotides per locus per generation (Sia et al., 2000 ) Microsatellite loci are inherently unstable with high mutation rates, a phenomenon that is reported to be caused by DNA polymerase slippage during DNA replication or repair. Unequal crossing-over. Errors during recombination (Li et al. 2002). Recombination is not the predominant mechanism in the generation of microsatellite variability. DNA polymerase slippage : DNA polymerase slippage During DNA replication or repair, DNA polymerase slippage can occur in which DNA strand temporarily dissociates from the other rapidly rebinds in a different position, leading to base-pairing errors and continued lengthening of the new strand and an increase in the number of repeats (i.e. additions) in the allele . Slide 19: Slippage during DNA replication. Assume that in the original molecule there were 5 repeats of the motif, symbolized by a box. Slippage leads to the formation of new alleles with 6 and 4 repeats, depending on the strand containing the polymerase error (Goldsteind and Schlotterer, 1999) Unequal crossing over : Unequal crossing over When unequal crossing-over occurs, there is a drastic changes such as the loss or gain of a large number of repeats. This is because when microsatellite repetitive regions are present, a hairpin can be formed during synapsis which means that only parts, usually unequal in length of each chromosome will be exchanged one chromosome will receive a larger fragment because of the larger number of microsatellite repeats exchanged, The homologues chromosome receiving a smaller number of repeats. Multiplexing in SSR : Multiplexing in SSR General standard are for PCR amplification protocols used for SSRs. several PCR products (different SSR loci) can be pooled (multiplexing) for electrophoresis. Multiplexing allows rapid genotyping of large sample sizes across several loci. Wheat microsatellite markers : Wheat microsatellite markers First large set of microsatellite markers - published in 1998 (Röder et al., 1998). 50% of the wheat SSR markers detect only a specific locus on one of the three genomes and thus are genome-specific. large sets of wheat microsatellite markers developed from various sources At Gatersleben, most of the approximately 1.000 identified SSR markers wmc markers are derived from libraries of wheat sequences that were generated through a variety of enrichment procedures Microsatellite motives identified within EST sequences through bioinformatic data. Mining and are usually more highly conserved The mapping of approximately 2.000 to 2.500 SSR markers on the 21 wheat chromosomes Slide 26: Molecular linkage map of wheat based on 70 recombinant inbred lines Slide 27: Molecular linkage map of wheat based on 70 recombinant inbred lines SSR application in wheat : SSR application in wheat Localization of individual genes onto the 21 wheat chromosomes - disease resistance genes or agriculturally important traits Localization of a large set of QTLs (quantitative trait loci) affecting Morphological and agronomically important traits QTLs are loci affecting resistance against the scab disease Determination of genetic diversity over time Organisation of DNA repeat motifs : Organisation of DNA repeat motifs Insitu hybridization of labeled sequence powerful tool Schmidt and Helsop- Harrinson (1996) characterized – SSR distribution- synthetic probes- detect SSR- in FISH Cuadrado and Schwarzacher (1998) – 10 SSR motifs- chromosomes of wheat, rye and barley- special role of SSRS In chromosome organization Simple oligonucleotides (AG12), (AAC)5, (AAG)5 and (CAT)5- hybridization signal of different intensity- useful- chromosome identification – understanding chromosome organization in wheat Also (AAC)5 AND (AAG)5 –useful – indentifying individual rye chromosomes Improving SSR detection using synthetic probes : Improving SSR detection using synthetic probes Distribution of SSRS in genomes- improved – modifying labeling of probes and increase the stringency of FISH First assay to reveal ssr sites – using in situ hybridisation employing short oligonucleotides. These sequences were end lebelled the enzyme terminal deoxy nucleotidyl transferase and biotin or digoxigenein modified nucleotided attached at 3’ end Cuadrado et al (2000)- FISH in which SSR- nucleotides –labelled with biotin or digoxigenin –random primer technique Distribution of SSR in wheat, rye and barley : Distribution of SSR in wheat, rye and barley FISH techniques – analyse the distribution of all possible classes of di- and trinucleotide SSR in chromosome of chinese spring, petkus and plaisant This analysis allowed – comparison of physical map of three crops All dinucleotide repeats, excluding homomeric dinucleotides grouped into 4 motifs: AT, GC, AG And AC. These respresents 12 complemnetary BUT OVERLAPING UNITS Slide 32: Occurance and disrtibution sites of some SSR on chromosomes of wheat, rye and barley (AC)8 : (AC)8 Euchromatic distribution with centromeric regions of the chromosomes Absence of AC – heterochromatin region in rye Easily observed – DAPI staining properties (AG)12: Clusters characterized by – high conc. Of AG Repeats observed – exclusively on chromosomes arms 3BS, 4BL, 5BS and 5BL OF WHEAT Distinct signals- observed on 7 chromosomes of R genome in rye similar intensity signals- centromeres of all barley chromosomes Slide 35: (AAG)5 Distribution basically coincide with – N bands and corresponds with AAG rich satellites and localized in chromosomes Not detected in chromosomes 1A, 3D, 4D, 5D and 6D but present in all chromosomes of wheat Single signals at interstitial position next to centromere in chromosomes arms 2RL, 3RS and 6RL in rye. In barley- a rich set of markers- all a seven chromosomes Slide 36: (AAC)5 In barley and wheat, major hybridization coincide with heterochromatin Presence of many motif specific intercalary sites in both species renders insitu hybridization Chromosomes 2A, 4A, 7A and all cho. of B genome of wheat can be accurately identified (fig.2a) All seven – barley chromosomes can also be distinguished Allows unequivocal identification of all related wild species of genus secale Slide 37: (AGG)5: All chro. Of A and B genome of wheat show insitu hybridization with this probe In barley, resembles that of (AAC)5 And (AAG)5. Rye chromosomes: distinctive signals (CAC)5: Pericentromeric regions of B genomein wheat. Tow A genome chr. (2A & 4A) show single band In barley, signals of different intensities in centromere Rye- signals on all chr. at different position Slide 38: (ACG)5: B genome chromosomes of wheat. However, strong signals restricted to 4B, 6B and 7B. Rye – on 7 chr. Strongest at centromere in barley, SSR detected at centromere (CAG)5: unequal distribution in 3 sps. Strongest signal observed on 1A and B genome of wheat in pericenric region. 7 rye chr.- rich pattern of signals Slide 39: (CAT)5: less common Only detectable CAT Cluster – in 3BL of wheat-easy to identify No (CAT)5 is observed – remaining chr. of wheat or rye Its distinctive pattern in chro. 4H and 5H In barley (ACT)5: Clear intercalary hybridization signals of diff. intensity in A and B genomes. Subtelomeric and pericentromeric signals observed on chr. 2H,3H, 4H, 5H and 6H of barley Not observed in rye chr. Slide 40: (AAT)5: Pericentromeric region of B genome Single signals are frequently observed on 1A and 7A No specific clustering in other sps. (GCC)5: Similar dispersed hybridization pattern in all 3 species Resembling the distribution pattern of (AC)8 Variable presence of SSR motif : Variable presence of SSR motif AC shows a greater dispersion of insitu hybridization signals than AG in wheat and barley AG repeats > AC repeat in wheat and barley database AAG and AGG and AAC – most common motifs in barley and wheat Frequency of motif- GCC motif most frequent motif Synthetic oligonucleotides SSR- landmarkes for chr. identification : Synthetic oligonucleotides SSR- landmarkes for chr. identification SSR probes are versatile tool- cytogentics SSRS when used as probes for insitu hybridisation (AAG)5 in all 3 species able to identify many chr. In complement at once (ACT)5- hybridize clearly at different position-allows easy identification of all barley chr. SSRS are found only one or few individual chr. E.g. (AAG)5 in rye and (CAT)5 in wheat and barley Form basis of identification- whole chr. But also chr. segments Are SSR involved in chromosome function? : Are SSR involved in chromosome function? Distribution of motif AAC and ACG IN three sps.- suggested – different SSR are of functional importance An ancient genomic component of the tribe triticeae AC repeat – similar dispersed hybridization pattern associated with eukaryotic portion of genome- excluded from heterochromatin Relationship between AC repeats and high levels of gene activity Presence of long clusters of SSR in the primary constriction of chr. – related to centromeric function Advantages of SSR over other markers : Advantages of SSR over other markers SSRs are now the marker of choice in most areas of molecular genetics as they are highly polymorphic even between closely related lines. require low amount DNA. High genomic abundance. can be easily automated. can be exchanged between laboratories. Gupta et al., 1999 Disadvantages : Disadvantages Development of SSR is labor intensive. Cost of development is high. Species specific. Heterozygotes may be misclassified as homozygotes when null-alleles occur due to mutation in the primer annealing sites. Stutter bands on gels may complicate accurate scoring of polymorphisms

Add a comment

Related presentations

Related pages

Comparative use of InDel and SSR markers in deciphering ...

Comparative use of InDel and SSR markers in deciphering the interspecific structure of ... the description of the organisation of the Citrus ...
Read more

Identification of SNP and SSR markers in eggplant using ...

Identification of SNP and SSR markers in eggplant using ... which will prove useful for extending our current knowledge of the genome organization of ...
Read more

Molecular implications from SSR markers for stripe rust ...

MOLECULAR IMPLICATIONS FROM SSR MARKERS ... followed by its sequence organization ... from SSR markers for stripe rust (Puccinia striiformis f.sp ...
Read more

Development, characterization, and transferability to ...

Development, characterization, and transferability to other ... Development of pepper SSR markers from ... Mapping and genome organization of ...
Read more

Microsatellite Markers - Gramene

Microsatellite Markers. ... Development and Mapping of 2240 New SSR Markers for Rice (Oryza ... Mapping and genome organization of ...
Read more

Ssr Marker - academic.research.microsoft.com

... Journal | Organization ... Ssr Marker,Ssr Marker,SSR markers,SSRS markers.
Read more

Identification of SNP and SSR markers in eggplant using ...

Identification of SNP and SSR markers in eggplant using RAD tag ... over 1,000 SSR markers were developed ... knowledge of the genome organization of ...
Read more

DArT markers: diversity analyses, genomes comparison ...

... of DArT markers developed from genomes of different Triticum species and SSR markers across the ... and genome organisation and ... BMC Genomics . 2006 ...
Read more