NDUFB11 original presentation

33 %
67 %
Information about NDUFB11 original presentation

Published on March 16, 2016

Author: PatrizioPanelli

Source: slideshare.net

1. Department of Medical Biochemistry, Biology and Physics (DIBIFIM), University of Bari, Italy Effect of silent, missense and nonsenseEffect of silent, missense and nonsense mutations on the exonic identification of themutations on the exonic identification of the complex I NDUFB11 genecomplex I NDUFB11 gene

2. EXON I INTRON I EXON IIIEXON II INTRONIIUTR UTR AAAAA7mG EXON I EXON IIIEXON IIUTR UTR AAAAA EXON I EXON IIIUTR UTR AAAAA SV1 SV2 • To generate the correct mRNA, exons must be identified and joined together in a specific manner; this process requires the action of a series snRNPs (U1,U2…) and more than 50 polypeptides • It has been estimated that at least 74-88% of the approximately 30,000- 40,000 genes in the human genome undergo “alternative splicing” encoding over 1 milion proteins (human proteome)

3. ---------------18bp/40bp------------- - O H U1U1 snRsnR NPNP U1U1 snRsnR NPNP U2 snRNP 35 Srm160 70K Da70KDa cis acting elements: 5’ splicing site (donor) 3’ splicing site (acceptor) branch site enhancers (ESEs) silencers (ESSs) intron-splicing processing element (ISPE) trans acting elements: UsnRNPs (small nuclear ribonucleoproteins) SR (serine/arginine rich proteins) HnRNPs (heterogeneous nuclear ribonucl.)

4. • The Drosophila Melanogaster Dscam gene encodes 38.016 different proteins, through “alternative splicing” Splicing has an important role in expanding protein diversity and must be precisely regulated

5. Premature Termination codon (nuclear scanning mechanism) Chaim Wachtel, Binghui Li, Joseph Sperling, and Ruth Sperling Stop codon-mediated suppression of splicing is a novel nuclear scanning mechanism not affected by elements of protein synthesis and NMD - RNA journal 2004

6. NDUFB11 GENE 153 are essential for the stability for the complex I of the respiratory chain X chromosome locus p11.3-p1123 153 amino acids 163 amino acids Alternative transcripts size 2,7kb SV1 SV2

7. BGH20N 500 bp 600 bp 700 bp M ESSS-F 1 2 3 exogenous ESSS-R endogenous ESSS-F 1 2 3 1 2 3 400 bp 500 bp 600 bp 1 2 3 PRIMERS PRIMERS NDUFB11 GENE RP11 96A6 0 20 40 60 80 100 120 RelativeExpression Endogenous Exogenous 153 163

8. Mutation …….…AGG-TGC-ACA-GGG-TGT-CCA-AGA-GCG-TGG-GAT-GGG-TAA……… Wt ….…AGG-TGC-ACA-GGG-TGT-CCA-TGA-GCG-TGG-GAT-GGG-TAA……….A17T ……….AGG-TGC-ACA-GGG-TGT-CCA-GGA-GCG-TGG-GAT-GGG-TAA……… A17G ……….AGG-TGC-ACA-GGG-TGT-CCA-CGA-GCG-TGG-GAT-GGG-TAA……….A17C ……….AGG-TGC-ACA-GGG-TGT-CCA-AGA-GCG-TAG-GAT-GGG-TAA……… G24A ……….AGG-TGC-ACA-GGG-TGT-CCA-AGA-GCG-TCG-GAT-GGG-TAA……… G24C ……….AGG-TGC-ACA-GGG-TGT-CCA-AGA-GCG-TTG-GAT-GGG-TAA……… G24T ……….AGG-TGC-ACA-GGG-TGA-CCA-AGA-GCG-TGG-GAT-GGG-TAA……….T13A ……….AGG-TGC-ACA-GGG-TGC-CCA-AGA-GCG-TGG-GAT-GGG-TAA……….T13C ……….AGG-TGC-ACA-GGG-TGG-CCA-AGA-GCG-TGG-GAT-GGG-TAA……….T13G 1 2 3 4 5 6 7 8 9 10 arbitrary codon position 1---2 3 4 5 6 7 8 9 10 111213 141516 171819 202122 232425 262728 293031--32 arbitrary Nucleotide position M. NONSENSEM. NONSENSE M. NONSENSEM. NONSENSE M. NONSENSEM. NONSENSE M. MISSENSEM. MISSENSE M. MISSENSEM. MISSENSE M. MISSENSEM. MISSENSE M. MISSENSEM. MISSENSE M. MISSENSEM. MISSENSE M. SILENTEM. SILENTE

9. Codon potition G 24T G 24C W t G 24A TGG TTG TAG TCG 8 100 bp 200 bp 300 bp 2 3 2 3 2 3 NDUFB11 inEx2-F ESSS-R Codon position T13A W t T13C T13G A17T A17G A17C TGA CGA GGA TGT TGA TGC TGC ------------------------ AGA --------------------------- 4 2 3 2 3 2 3 100 bp 200 bp 300 bp 6 RT-PCR SPLICING ANALYSIS

10. Premature Termination codon (nuclear scanning mechanism) Chaim Wachtel, Binghui Li, Joseph Sperling, and Ruth Sperling Stop codon-mediated suppression of splicing is a novel nuclear scanning mechanism not affected by elements of protein synthesis and NMD - RNA journal 2004

11. 1---2 3 4 5 6 7 8 9 10 111213 141516 171819 202122 2324 25 262728 2930 31-32 nucleotides .…AGG-TGC-ACA-GGG-TGT-CCA-AGA-GCG-TGGGAT-GGG-TAA……… Wt mutation into the position 24-25-26 W t G 25C 2 3 2 3 2 3 G 26C W t hnRNPH1 consensus motif: DGGGD

12. Mutations …….…AGGTGCACAGGGTGTCCAAGAGCGTGGGATGGGTAA……… Wt ……….AGGTGCACAGGGTGTCCAAGAGCGTAGGATGGGTAA……… G24A ……….AGGTGCACAGGGTGTCCAAGAGCGTCGGATGGGTAA……… G24C ……….AGGTGCACAGGGTGTCCAAGAGCGTTGGATGGGTAA……… G24T …….…AGGTGCACAGGGTGTCCAAGAGCGTGCGATGGGTAA……… G25C …….…AGGTGCACAGGGTGTCCAAGAGCGTGGCATGGGTAA……… G26C …….…AGGTGCACAGGCTGTCCAAGAGCGTGGGATTGGTAA……… G10C …….…AGGTGCACAGGCTGTCCAAGAGCGTGCGATTGGTAA……… G29T 1--2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 arbitrary Nucleotide position G 24T G 24C W t G 24A 100 bp 200 bp G 25C G 26C W t W t A B Ndufb11 (L) Ndufb11 (S) G 10C hnRNP consensus sequences mutation G 29T

13. H1-Real-F 5’-GGTGGAGAGGGATTCGTGGTG-3’ H1-Real-R 5’-TTGGTCTGCCTTCTCTGGTGTAG-3’ 0 20 40 60 80 100 hnRNPH1 mRNA Real Time Ctrl siRNA

14. 100 bp 200 bp 300 bp +_ SILENCING OF hnRNPH1 AFFECT THE SPLICING OF THE NDUFB11 GENESILENCING OF hnRNPH1 AFFECT THE SPLICING OF THE NDUFB11 GENE hnRNPH1 siRNA 2 3 2 3 2 3

15. nmoli/min/mgprot 0 5 10 15 20 25 CI COX 153 163 163 153 Ctrl #1 #2 #3 #4 #5 Mature153His 39 17 Complex I Ctrl Complex IV CI Mature163His CIII CIV 39 17 Core II Cox IV BN - PAGE/SDS-PAGE A Core II Cox IV B c activity CI CIII CIV

16. 153 Dichlorofluorescein ASSAY 163

17. Bcl-X (L) Bcl-X (S) Ndufb11 (L) Ndufb11 (S) Rot. 20 µM 500bp 200 bp 300 bp 400bp 0h 24h 48h0h 24h 48h HEK SHSY-5Y 200 bp Bcl-X gene 0h 24h 48h HFY SHSY-5Y 0h 24h 48hRot. 20 µΜ 0h 24h 48h 0h 24h 48hRot. 20 µM HFY SHSY-5Y SH-SY5Y HEK Rot. 20 µM +- +- H1 β-actin WESTERN-BLOT hnRNP H1 Ndufb11 gene S L S L

18. control Rotenone TUNEL (TUNEL (TerminalTerminal deoxynucleotidyl transferasedeoxynucleotidyl transferase ) imaging Assay) imaging Assay 153 163 control

19. 2 GG 3GGGGGGhnRNPH hnRNPH hnRNPH hnRNPH hnRNPH hnRNPH hnRNPH hnRNPH hnRNPH hnRNPH hnRNPH hnRNPH U1U1 snRNPsnRNP U1U1 snRNPsnRNP U1U1 snRNPsnRNP U1U1 snRNPsnRNP U1U1 snRNPsnRNP U1U1 snRNPsnRNP U1U1 snRNPsnRNP U1U1 snRNPsnRNP U1U1 snRNPsnRNP U1U1 snRNPsnRNP U1U1 snRNPsnRNP hnRNPH consensus motif: DGGGD

20. 2 GG 3GGGGGG U1U1 snRNPsnRNP U1U1 snRNPsnRNP U1U1 snRNPsnRNP hnRNPH hnRNPH hnRNPH hnRNPH U1U1 snRNPsnRNP U1U1 snRNPsnRNP

21. •The selection of the splicing site is not PTC dependent, but nonsense as well as missense and silent mutation can alterate the splicing only if they are localized into a cis regulatory element context •The 163 protein is localized into the complex I •During the apoptosis process, NDUFB11 gene switchs the splicing to encode the 163 protein which, competing with the physiological 153 isoform, leads the complex I to produce R.O.S facilitate the apoptosis

Add a comment

Related pages

PSEUDOGENES AND THE ELECTRON TRANSPORT CHAIN

In this presentation, ... the original mRNA transcript, thus affecting their expression.18, 22, 23 ... NDUFB11 2819 953 3 1
Read more

Gene Expression Profiling of Mitochondrial Oxidative ...

... NDUFA5, NDUFA10, NDUFA12, NDUFB10, NDUFB11 ... Trouillas P, et al. (1999) Friedreich's ataxia: point mutations and clinical presentation of ...
Read more

Mitochondrial disease: genetics and management ...

Mitochondrial disease: genetics and management. ... NDUFB11. X-linked Leigh ... Pavlakis SG, DeVivo DC, DiMauro S, Rowland LP (1992) MELAS: an original ...
Read more

Patent US20100130527 - Individualized cancer treatment ...

Original Assignee: Lehrer Raphael, Robert Coopersmith: Export Citation: BiBTeX, ... TGFBR, TGFBR1, TRIM35, Type I Receptor, UHMK1, VPS29, VPS35, ZFYVE16: 79:
Read more

TRAM (Transcriptome Mapper): database-driven creation and ...

BMC Genomics main menu. ... NDUFB11+ RBM10+ UBA1+ INE1+ USP11- ZNF157+ ZNF41+ ARAF+ SYN1 ... HLA-DQB1, TAP2 - involved in antigen presentation -, HLA-DMB ...
Read more

Mitochondrial disease: genetics and management - Springer

Mitochondrial disease: genetics and management. ... NDUFB11. X-linked Leigh ... Pavlakis SG, DeVivo DC, DiMauro S, Rowland LP (1992) MELAS: an original ...
Read more

OrphaNews : the newsletter of the Rare Disease Community

... 269 out of 1892 clinically relevant original ... Histiocytoid cardiomyopathy linked to a de novo NDUFB11 ... This presentation is part ...
Read more

TRAM (Transcriptome Mapper): database-driven creation and ...

... .org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. ...
Read more