Molecular Markers in Crop Plants

40 %
60 %
Information about Molecular Markers in Crop Plants
Education

Published on November 23, 2008

Author: chhabra61

Source: authorstream.com

Slide 1: Molecular Marker-Assisted Selection in Crop Plants (MAS) A.K. Chhabra Department of Plant Breeding CCS Haryana Agricultural University Hisar 125 004 Slide 2: x DEVELOPMENT OF MAPPING POPULATIONS Slide 4: RFLP AFLP SSR SNP RFLP AFLP SNP SSR Screening of population and parents ISOLATION OF DNA : ISOLATION OF DNA Highly Pure High throughput technique PROTOCOL depends upon the marker technique to be used Slide 6: Preparation of Gel Running of Gel Scoring of Gel Slide 7: MONOMORPHISM Vs. POLYMORPHISM V1 V2 V3 V4 V5 V6 V7 V8 V9 V10 V11 V12 V13 2 Gps. 3 Gps. 8 Gps. 11 Gps. © A.K. Chhabra Slide 8: Isozyme Markers Isoenzymes allozymes EST ADH SKDK SOD LDH ME POX Etc. SOURCE STAGE LOCATION YEAR MACRO ENVT. MICRO ENVT. PLANT PART/TISSUE Electrophoretic separation © A.K. Chhabra Slide 9: Substrate Product EST V1 V2 V3 V4 V1 Yellow V2 Red V3 Green V4 Pink © A.K. Chhabra Slide 10: Role of Isozymes (38 PAGES REVIEW ARTICLE IS ATACHED) Disease resistance Cultivar Identification Cytoplasmic diversity/cytoplasmic male sterility Genetic diversity and geographical distribution Reproduction behaviour Phylogenetic relationships Confirmation of the introgressed gene in the hybrid genome Cultivars identification Assessment of degree of isogeneicity Protogyny Chromosome depletion Tissue culture Aging effect Establishing linkage relationship(s) between d2 gene and enzymatic Markers Assessment of gametophytic competition Isozyme Markers Protocol MS Word © A.K. Chhabra Slide 11: DNA Markers AFLP Amplified Fragment Length Polymorphism ALP Amplicon Length Polymorphism AP-PCR Arbitrary Primed PCR AS-PCR Allele-specific PCR CAPS Cleaved Amplified Polymorphic Sequences DAF DNA Amplification Fingerprinting RAPD Random Amplified Polymorphic DNA RFLP Restriction Fragment Length Polymorphism SCAR Sequence Characterized Amplified Regions SSCP Single Strand Cofirmational Polymorphism SSR Simple Sequence Repeats SSLP Microsaterllite Simple Sequence Length Polymorphism Minisatellite Simple Sequence Length Polymorphism STS Sequence Tagged Sites SNP Single Nucleotide Polymorphism AFLP Amplified Fragment Length Polymorphism ALP Amplicon Length Polymorphism AP-PCR Arbitrary Primed PCR AS-PCR Allele-specific PCR CAPS Cleaved Amplified Polymorphic Sequences DAF DNA Amplification Fingerprinting RAPD Random Amplified Polymorphic DNA RFLP Restriction Fragment Length Polymorphism SCAR Sequence Characterized Amplified Regions SSCP Single Strand Cofirmational Polymorphism SSR Simple Sequence Repeats SSLP Microsaterllite Simple Sequence Length Polymorphism Minisatellite Simple Sequence Length Polymorphism STS Sequence Tagged Sites SNP Single Nucleotide Polymorphism A Brief Discussion and Uses of DNA Markers……. © A.K. Chhabra Slide 12: DNA Markers as Fundamental Links between Plant Breeding and Plant Biology Assessing Genetic Diversity and Merit A. Germ Plasm Identification, Classification, and Management B. Parent Selection C. Limits of Assessing Genetic Diversity via DNA Markers Genome Architecture: Genetic and Physical Characterization of Crop Plant Genomes A. Development of Integrated Maps B. Relating Genetic and Physical Distances in Crop Plant Genomes C. Insights into Recombination and Its Role in Generating Genetic Variation D. Map-Based Cloning Comes of Age Analysis of Complex Traits and Phenomena A. Quantitative Inheritance Patterns B. Assessing and Introgressing Exotic Germ Plasm C. Response to Selection in Plant Breeding Programs Marker-Assisted Selection A. Deterministic and Simulation Studies of MAS in Plant Breeding Programs B. Empirical Results C. Integrating MAS into Plant Breeding Programs DNA Markers in Cultivar Development Programs © A.K. Chhabra Slide 13: RFLP markers arise as a result of Mutations: substitution of a single nucleotide rearrangements in the DNA intervening between two restriction sires Such rearrangements might include deletion insertion and/or transposition or error in DNA replication. © A.K. Chhabra Slide 14: How Substitution leads to RFLP………………… AGCTTATTCGGATTCAAGGATCCTTCGGATTCAACTA MUTATED G to T AGCTTATTCGTATTCAAGGATCCTTCGG ATTCAACTA RESTRICTION FRAGMENTS AGCTTATTCGGTTTCAAGGATCCTTCGGATTCAACTA Results into Restriction Fragment Length POLYMOPRPHISM deletion insertion and/or transposition or error in DNA replication ACT IN THE SAME WAY © A.K. Chhabra Slide 15: RFLP Technique DNA isolation (text file) Digestion of the DNA with a restriction enzyme Separation of the restricted fragments by agarose gel electrophoresis/PAGE Southern Blotting Detection of individual restriction fragments by nucleic acid hybridization with labeled cloned probes, Scoring of RFLPs by direct observation of autoradiograms. © A.K. Chhabra RFLP ANIMATED Slide 16: Fingerprinting Example How it is done? Technique © A.K. Chhabra Slide 17: Sponge Dry Tissue Papers Weight Southern Blotting (Southern, 1975) Gel DNA Nitrocellulose membrane Slide 18: Probing / Hybridization Slide 19: 001100011100010101000101 ++-++---+++++--++++++++-+- Autoradiography and Gel Scoring Feeding Data in Computer Slide 20: mtDNA RFLP Cytoplasmic male sterility sources in pearl millet Haplotype Concept 1 Calculations Slide 21: drDNA Dispersed repetitive DNA for fingerprinting c/a Oligonucleotide in-gel hybridization OR Oligonucleotide in-gel Fingerprinting Same as RFLP EXCEPT S-Blotting step is excluded (gels are dried and used directly for hyb.) Probe used is a REPETITIVE DNA SEQUENCE (SSR, VNTRs, STRs etc.) ADVANTAGE: Repeat sequences used are multilocus probes thus reveal polymorphism at many loci simultaneously DISADVANTAGE: Sometimes gives less no. of bands eg. In wheat and tomato. 2-15bp length

Add a comment

Related presentations

Related pages

Molecular Markers - Science 2.0

... crop genomes. These molecular techniques, in particular the applications of molecular markers, ... crop plants, valuable markers ...
Read more

Molecular Breeding and Marker-Assisted Selection - ISAAA.org

Molecular Breeding and Marker-Assisted Selection. ... plant breeders have selected plants based on ... The main uses of these molecular markers in crop ...
Read more

Molecular Markers and Marker-Assisted Breeding in Plants ...

Molecular Markers and Marker-Assisted Breeding ... the family of plant breeding as various types of molecular markers in crop plants were developed during ...
Read more

Molecular markers in plant genome analysis

Applications of molecular markers in plant genome analysis and breeding. ... Apart from use of molecular markers in crop plants ...
Read more

Potential of Molecular Markers in Plant Biotechnology

... the use of molecular markers, ... marker of choice for the study of crop genetic ... B. Molecular Markers: A molecular markers a DNA
Read more

Review : The Importance of Molecular Markers in Plant ...

Review The Importance of Molecular Markers in Plant Breeding Programmes. ... technology for bring genetic improvement in crop plants would
Read more

Genetically Modified Crops: 2. How can biotechnology be ...

Genetically Modified Crops. ... 2.3 What are molecular markers and how ... Most of the genetically modified crop plants used so far have transgenes ...
Read more

Application of Molecular Markers for Breeding Disease ...

Application of Molecular Markers for Breeding Disease Resistant Varieties in Crop ... Molecular markers ... Marker assisted selection in crop plants.
Read more

Introduction to Molecular Markers and their Application in ...

Molecular Markers 1. What are ... plants. You will isolate DNA ... For each molecular marker to be tested for linkage with “tb” mutant, ...
Read more