La genética molecular

40 %
60 %
Information about La genética molecular

Published on March 7, 2014

Author: intelicienciabach

Source: slideshare.net

http://www.youtube.com/watch?v=CJakYmgtrDA&feature=related

Para conocer el ADN Para conocer el ADN tenemos que saber: tenemos que saber: Su composición Su composición Su estructura Su estructura Cómo se transmite Cómo se transmite la información la información de generación de generación en generación en generación Cómo se expresa su Cómo se expresa su información información

Composición del ADN El ADN se compone de unas unidades denominadas nucleótidos. En el ADN existen 4 tipos de nucleótidos distintos El ADN está constituido por muchos miles de nucleótidos Lo que diferencia a unos ADN de otros es el orden de los miles de nucleótidos que lo forman.

¿De qué se compone un nucleótido? Un nucleótido se compone de tres moléculas que aparecen unidas:    Grupo fosfato Azúcar Base nitrogenada Nucleótido Guanina Citosina Pueden ser: Timina Adenina

Las cadenas de nucleótidos Los nucleótidos se unen entre sí formando largas cadenas, además dos cadenas se asocian para formar una molécula de ADN . . . .

LA SECUENCIA DE NUCLEÓTIDOS El orden en que se unen unos nucleótidos con otros se . denomina secuencia y tiene una gran importancia, pues contiene la información que después se expresará en forma de proteínas T-C-A-G-.............................

LA ESTRUCTURA DEL ADN  En 1953 Watson y Crick determinaron cómo era la estructura tridimensional de esta molécula. Cada molécula de ADN está formada por dos cadenas de nucleótidos enrolladas formando una doble hélice

La estructura de la doble hélice recuerda a una escalera de caracol el pasamanos lo constituiría la parte invariable, formada por la sucesión de fosfatos y desoxiribosas los peldaños la parte variable, donde se encuentran las bases nitrogenadas  

La estructura del ADN Cada peldaño está constituido por dos bases nitrogenadas, una de cada cadena, unidas entre sí mediante enlaces. Siempre se une: Adenina con Timina y Guanina con Citosina,

La estructura del ADN Como las bases siempre se emparejan de la misma manera, decimos que son complementarias. Sabiendo la secuencia de bases de una cadena podemos deducir la otra. ATGGCTTAACAATCCCGGGTACGTA TACCGAATTGTTAGGGCCCATGCAT

La estructura del ADN El ADN constituye largas cadenas. Cada molécula de ADN forma, junto a otras moléculas denominadas histonas, una sustancia denominada cromatina, durante la división celular la cromatina se condensa y forma los cromosomas ¿Cuántas moléculas de ADN hay en cada célula de un ser humano? 46

Expresión de la información genética. •Los genes contienen información que debe ser expresada •La información contenida en el ADN se expresa a través de las proteínas. • Un gen es un fragmento de ADN que contiene la información para la síntesis de una proteína.

Expresión de la información genética •Las proteínas son macromoléculas formadas por la sucesión de moléculas más pequeñas llamadas aminoácidos. • Las proteínas contienen 20 aminoácidos diferentes que se ordenan y repiten en función de la información contenida en el ADN

Expresión de la información genética. Uno de los científicos que contribuyó a descubrir como se realizaba esta traducción fue Severo Ochoa. Su trabajo en este campo le valió el Premio Nobel.

Expresión de la información genética •¿Cómo se expresa la información contenida en el ADN en las proteínas? 1.- La información contenida en el ADN se transcribe a una molécula de ARN (ácido ribonucleico) que una vez formada abandona el núcleo para dirigirse al citoplasma. 2.- La información genética se traduce al lenguaje de las proteínas en los ribosoma.Cada cadena de ARN dará lugar a una proteína

Expresión de la información genética. La transcripción ADN ARN ACCGGTACTGACAGTACTTCC TGGCCATGACTGTCATGAAGG Molécula de ADN

Expresión de la información genética. La transcripción. ACCGGTACTGACAGTACTTCC UGGCCAUGACUGUCAUGAAGG TGGCCATGACTGTCATGAAGG •Las dos cadenas de ADN se separan •Una de ellas sirve de patrón para la síntesis de una cadena de ARN. A esta molécula de ARN se le denomina ARN mensajero https://www.youtube.com/watch?v=bXNMRJEWcK0 https://www.youtube.com/watch?v=mFh9L-nu8Hk

Expresión de la información genética. La transcripción. Características del ARN: •Está constituido por una sola cadena •Contiene ribosa en vez de desoxiribosa. •Las bases nitrogenadas que contiene son: ADENINA GUANINA CITOSINA URACILO (en vez de timina)

Expresión de la información genética. La traducción ARN Proteínas Se traduce un lenguaje con cuatro signos (las cuatro bases nitrogenadas) a un lenguaje con veinte signos (los veinte aminoácidos que componen las proteínas) https://www.youtube.com/watch?v=rDOVOOQVgtE ´

Expresión de la información genética. La traducción Tiene lugar en los ribosomas, donde el ARNm lleva la información del ADN Proteína en formación Ribosoma Aminoácido AUG CCU CAU AGU GGC UAA ARN Los aminoácidos son conducidos al ribosoma por el ARNt, y unidos según indica la secuencia de nucleótidos del ARNm

Expresión de la información genética. La traducción AUG CCU CAU AGU GGC UAA ARN

Expresión de la información genética. La traducción AUG CCU CAU AGU GGC UAA ARN

Expresión de la información genética. La traducción AUG CCU CAU AGU GGC UAA ARN

Expresión de la información genética. La traducción AUG CCU CAU AGU GGC UAA ARN

Expresión de la información genética. La traducción Aquí se observa como varios ribosomas trabajan a la vez para conseguir varias copias de la proteína.

Expresión de la información genética. El código genético establece la relación que hay entre los tripletes de bases y los aminoácidos de las proteínas

Expresión de la información genética. Deduce la secuencia de aminoácidos AUG CCU CAU AGU GGC UAA

3.-La replicación del ADN La información genética debe ser transmitida de un individuo a otro o, simplemente, de una célula a otra. •¿Qué proceso celular garantiza que cada célula hija resultante de una división celular recibe la misma información genética? •¿Qué tiene que ocurrir previamente para que esto pueda ocurrir? •¿En qué fase del ciclo celular ocurre?

La replicación del ADN •Es un proceso que tiene lugar durante la interfase de la vida de la célula. •Es posible gracias a la complementariedad de bases •Ocurren dos acontecimientos claves: •Las dos cadenas que forman la molécula de ADN se separan. •Cada una de las cadenas sirve de molde para la formación de una nueva cadena ACCGTTAC ACCGTTAC TGGCAATG TGGCAATG ACCGTTAC https://www.youtube.com/watch?v=T-g-G0-kehU TGGCAATG

La replicación del ADN

4.-Las mutaciones M u ta c io n e s C ro m o s ó m ic a s A fe c ta n a la e s tru c tu ra d e l c ro m o s o m a G e n ó m ic a s A fe c ta n a l n ú m e ro d e c ro m o s o m a s G é n ic a s S e p ro d u c e n d u ra n te la re p lic a c ió n P e rd id a d e b a s e s In s e rc ió n d e b a s e s C a m b io d e b a s e s

Las mutaciones L a s m u t a c io n e s P ueden ser E s p o n tá n e a s R a d ia c io n e s I n d u c id a s S u s t a n c ia s q u ím ic a s

Las mutaciones L a s m u t a c io n e s S e p u d e n p r o d u c ir s o b r e C é lu la s s o m á t ic a s E s c r ib a a q u í e l c a r g o P u e d e n d a r lu g a r a la a p a r ic ió n d e u n c á n c e r N o s e t r a n s m it e n a la d e s c e n d e n c ia C é lu la s r e p r o d u c t o r a s E s c r ib a a q u í e l c a r g o S e tr a n s m it e n d e g e n e r a c ió n e n g e n e r a c ió n A f e c t a n a t o d a s la s c é lu la s d e l o r g a n is m o

Add a comment

Related presentations

Related pages

Genética molecular - Wikipedia, la enciclopedia libre

La genética molecular (no confundir con la biología molecular) es el campo de la genética que estudia la estructura y la función de los genes a nivel ...
Read more

Genética Molecular | Genética - Técnicos para Bioterio

La genética molecular es la rama que estudia la estructura y la función de los genes a nivel molecular. Un gen es la unidad física y funcional de la ...
Read more

Blog educativo de genética - TECNOLOGIA MOLECULAR GENOMICA

Blog educativo y de divulgación de genética. Por Gabriela Marisa Iglesias. Med. Veterinaria. Mag. en Biotecnología. Prof. Asociada Genética Univ ...
Read more

Que es la genetica molecular? | Yahoo Clever

Beste Antwort: La Genetica Molecular , es una rama de la Biologia , que estudia la funciones y la estructura de los genes ( el gen es la unidad ...
Read more

Que Estudia La Genetica Molecular 2 - es.scribd.com

1) ¿Qué estudia la genética molecular? La genética molecular (no confundir con la biología molecular) es el campo de la biología que estudia la ...
Read more

Genética - Wikipedia, la enciclopedia libre

La genética (del griego antiguo ... Molecular: Estudia el ADN, su composición y la manera en que se duplica. Así mismo, estudia la función de los genes ...
Read more

TEMA 19: GENÉTICA MOLECULAR. - bionova.org.es

1 tema 19: genÉtica molecular. 1.- introducciÓn: el concepto clÁsico de gen y el nacimiento de la genÉtica molecular. el redescubrimiento de los ...
Read more

GENÉTICA MOLECULAR - ninlab.es

La Genética Molecular . Es el campo de la biología que estudia la estructura y función de los genes a nivel molecular. Los estudios de campo cómo los ...
Read more

Aplicaciones de la genética molecular - Julian Hernandez ...

Cibergrafias APLICACIONES DE LA GENÉTICA MOLECULAR: - Ingeniería Genética El conocimiento de los genes no sólo se limita a la Medicina. La posibilidad ...
Read more

Genetica Molecular - Scribd

GENETICA MOLECULAR. Bases moleculares de la herencia •Estructura ácidos nucleicos DNA y del RNA •Replicación •Almacenaje y expresión •Variación
Read more