Isolation and characterization of an extracellular antifungal protein from an endophytic fungal isolate

50 %
50 %
Information about Isolation and characterization of an extracellular antifungal protein...
Education

Published on February 21, 2014

Author: thesilverhelix

Source: slideshare.net

Description

Protein and Peptide Letters Published Article in Vol 20, Issue 2, February 2013
Abstract available here : http://www.ncbi.nlm.nih.gov/pubmed/22894154

Thesis Project Isolation and Characterization of an Extracellular Antifungal Protein from an Endophytic Fungal Isolate Kamdar Maulik Rajendra (07BT3007) Supervised by Professor Mrinal Kumar Maiti Department of Biotechnology, IIT Kharagpur

Introduction Endophytes: “microbes that colonize living internal tissues of plants without causing any immediate, overt negative effects” Found in virtually every plant on earth. Reside in the living tissues of the host plant and do so in a variety of relationships ranging from symbiotic to pathogenic. Plant host is able to supply the necessary nutrients and the compounds required for the endophyte to complete its life cycle. Fig. Endophyte grows inside cell Fig. Endophyte Life Cycle

The Study of Endophytes Increase of disease causing microbes, which are resistant to drug therapy  New antibiotics, chemotherapeutic agents to cure diseases  Natural selection has been found to be superior to combinatorial chemistry for discovering novel substances  Novel bio-molecules are obtained from organism, like endophytic fungi, that inhabits novel biotope.  Plants are directly used as medicines by a majority of cultures around the world, for example Chinese medicine and Indian medicine (Ayurveda).  Endophytes produce a wide range of bioactive natural compounds.  Medicinal plants are known to harbor Endophytic fungi.  This group of microbes are not extensively studied at all. 

Objectives Goal: To isolate and characterize an extracellular antifungal protein (exAFP-C28) from endophytic fungi Colletotrichum sp. (Strain-DM06) associated with a medicinal plant Ocimum sanctum. Isolation and molecular identification of endophytic fungal strain Study of fungal growth on various culture conditions to find out the characteristic changes in the expression of protein synthesis Isolation and Purification of the extracellular antifungal protein exAFP-C28 Determine minimal inhibition concentration (MIC) against Study the Candida albicans surface morphology of Candida albicans under effect of exAFP-C28 Determine effect of exAFP-C28 on membrane permeability Evaluation of hemolytic activity of exAFP-C28 Molecular Mass Determination and Protein Sequence Analysis Bioinformatics analysis of the primary amino acid sequence, homology modeling and prediction of amphipathic nature of the helixes.

Isolation of endophytic fungi 1 min Surface sterilization Fresh plant parts Distilled water Ethanol 95% 1 min Distilled water BLOT DRY 1 min 1 min NaOCl 0.5% Ethanol 95% Cut in section Incubate 25c for 7 days

Molecular Identification 1 ml of fungal culture which contains about 5 x 105 number of spores is inoculated in 100 ml culture media.  Culture grown at 28°C for 48 Hrs.  Mycelia is harvested from liquid culture by filtration through Whatman filter paper no1.  CTAB method used for fungal genomic DNA isolation.  Small subunit RNA (17-18S) primers TR1 TR2 GTTTCTAGGACCGCCGTA CTCAAACTTCCATCGACTTG Internal transcribed spacer region primers ITS1 ITS4 TCCGTAGGTGAACCTGCGG TCCTCCGCTTATTGATATGC Amplification performed with a denaturation step of 94°C for 3 min followed by 30 cycles of 94°C for 1 min denaturation, 55°C for 1 min, 72°C for 2 min and final extension of 72°C for 7 min.  The two amplified products (amplicons) were sequenced, and the sequences were analyzed by NCBI blast search. 

Optimization of Culture Conditions Colletotrichum sp. (Strain-DM06) was cultivated in various media. All liquid cultures were incubated in shaken 500 mL flasks containing 250 mL of medium at 28 °C and 150 rpm. The fungal isolate was cultivated in media containing different carbon sources, nitrogen sources, and ambient pH. Yeast extract peptone sucrose medium (YEPS) Yeast extract peptone dextrose medium (YEPD) Potato Dextrose Agarose Medium (PDA) Czapek DOX Broth Medium (CDX)

Separation of the Crude Protein  The media was inoculated and incubated at 150 rpm at 28oC for around 4 days.  Mycelia separated by Whatman Filter paper no1.  206 gm of (NH4)2SO4 added in small quantities every 10 minutes at 4°C , to avoid denaturation.  Incubation for the entire night and centrifugation for 30 minutes at 4oC and 10000 rpm, and dissolution in Ammonium acetate buffer provides the protein extract. It is tested with Bradford’s reagent.  Process was repeated for at least 10 times.  Following steps involve dialysis and lyophilization.  Protein Gel was run with the materials being prepared as stated above using a protein Gel apparatus.

Purification of the Crude Protein Amicon Ultra 4 Centrifugal Filter Devices Spin Conditions: 4 mL starting volume Fixed angle (25 degree), 5000 × g at 25 °C  15 min spin for separation of protein ≥100 kDa Fixed angle (25 degree), 7500 × g at 25 °C  5 min spin for separation of protein ≥ 50 kDa  10 min spin for separation of protein ≥ 30 kDa  10 min spn for separation of protein ≥ 10 kDa  20 min spin for separation of protein ≥ 5 kDa

Radial Susceptibility Assay  exAFP-C28 was diluted from 128μgml-1 to 0.06μgml-1 in 96 microtiter wells containing 0.4% glucose.  C. albicans cells were grown at 28 °C in YPD liquid medium for 3 hours, up to mid-exponential phase.  The fungal cells 2×103 per well was used as inoculum for susceptibility test. Separate wells containing no protein, well with only glucose and blank well were used as different controls. The plate was incubated at 28 °C for 24 hours.  The glucose utilization in each well was checked by Glucose Oxidase Assay Kit.

Scanning electron microscopy  C. albicans, grown at 28 °C in YPD medium, were treated with supra-MIC concentration of exAFP-C28 for 24 hours at 28°C.  10μl of the cell suspension, placed onto a 0.45μm filter, fixed with 2% glutaraldehyde for 1 hour, post-fixed with 1% OsO4.  Samples were loaded onto a graphite stub and kept in an auto sputter coater under low vacuum for gold coating up to 5min. Surface morphology of C. albicans cells was studied by using a SEM under 15-20 kV.

Flow Cytometry Analysis  Different concentrations of exAFP-C28 protein were incubated with 0.5 ml of C. albicans cell suspension at a fixed concentration (10 μg ml-1) of propidium iodide (PI) for 1 hour.  The fluorescence data due to entry of PI inside the cells was recorded by a FACS Caliber flow cytometer with a 488 nm laser wavelength, and analyzed by Cell QuestPro software.

Hemolytic Activity Assay  Blood sample was washed 3 times with PBS. Triton X-100 was used as positive control.  Aliquots (100 μl) of RBCs (8% suspension) were transferred to 96-well microtiter plate, and hemolysis was determined by measuring A570nm using the ‘Expert Plus UV’ (Emax) plate reader.  The percent (%) hemolysis was calculated as: % hemolysis = ( A570nm with protein solution – ( A570nm with 1% Triton − X 100 A570nm in PBS ) × 100 – A570nm in PBS )

Molecular Mass Determination and Protein Sequence Analysis Mass Spectometry Analysis  Molecular mass determined by Voyager DE ProTM mass spectrometer.  Spectrum recorded in the (+ve) ion linear mode in accelerating voltage 20 kV. Proteomics Analysis  Mass spectra of different peptides, obtained from protein digestion using Trypsin, were acquired in (+ve) ion reflector mode with range of 850–5000 Da.  Data was uploaded into MASCOT database to search the protein identity.

Bioinformatics Analysis Protein hydrophobicity and hydrophilicity predicted using algorithms of Kyte-Doolittle, Hoop-Woods and Garnier.  Homology model constructed using MODELLER 9v2.  Template: The crystal structure of 50S ribosomal protein L10 [Streptomyces avermitilis MA-4680]  Hydrophobic moments determined using the Totalizer module of Membrane Protein Explorer: N is the number of residues in the sequence segment, Hn is the numerical value of hydrophobicity of the n th amino acid residue from the Wimley-White interfacial hydrophobicity scale, δ= 2π/m, and m is the number of residues per turn.  N N µ H = {[∑ Hn sin(δ n)] + [∑ Hn cos(δ n)] n =1 2 n =1 2

Results PCR amplification yielded 2 amplicons of 542bp and 522bp. DNA fragments were sequenced and NCBI blast search was performed using the sequences of these amplicons obtained from each isolate. 99% sequence identity of the DM06specific amplicons with the genus Colletotrichum sp. The colony morphology of DM06 was cottony and grayish white mycelia with abundant bright orange conidial mass were found on the colonies.

Results Fig : (a) Phase-contrast microscopic picture of few spores. (b) Scanning electron microscopic view of the mycelial mat. (c) Phylogenetic tree constructed on the basis of 18S rRNA gene sequences of some fungi with their accession numbers in parenthesis. (d) The exAFP-C28 protein is neither a glycoprotein nor a lipoprotein as unveiled through carbohydrate-, protein- and lipid-specific staining.

Expression pattern of extracellular protein in different media M 1 2 3 4 28KDa Fig : SDS-PAGE of extracellular protein of Colletotrichum sp. grown on 4 different culture media. M;Size marker of protein, 1;YEPS media, 2;YEPD media, 3;PDA media, 4;CDX media.

Purification of 28 kDa fraction C 1 2 3 4 M Fig : Purification of the exAFPC28 protein from the culture supernatant of Colletotrichum sp. DM-06 grown in YPS medium. Coomassie Brilliant Blue stained SDS-PAGE (12%) showing the extracellular protein profile after fractionation through different cut-off of Amicon Ultra 4 Centrifugal Filter Devices. 28KDa Lane 1: Crude total extracellular protein, 2: Filtrate fraction of 100 kDa cutoff, 3: 50 kDa cutoff, 4: 30 kDa cutoff, 5: 3 kDa cutoff, Lane M: Protein molecular weight marker (in kDa)

Antibacterial Assay  The antimicrobial activity of all the isolated extracellular protein fractions was done.  28 kDa protein had the best antimicrobial activity than other fractions. The antimicrobial plate assay on E. coli DH10B showed inhibition zone surrounding the agar plaques when 2µg protein was loaded. Fig : Antimicrobial assay on E.coli, protein concentration used 0.5 µg/ml, 1.0 µg/ml, 1.5 µg/ml, 2.0 µg/ml

RSA and SEM Results Fig : (a) The MIC value of exAFP-C28 against C. albicans was found to be 32 µg ml-1. The RSA also revealed that glucose utilization by C. albicans gradually reduced and ceased in the wells containing >32 µg ml -1 of exAFP-C28. (b) The scanning electron microscopy image clearly indicated that the exAFP-C28 at a concentration of 32 µg ml-1 causes a significant damage in the cell wall in comparison to untreated cells

Flow Cytometry and Hemolysis Fig : (a) Enhanced fluorescence level of propidium iodide (at fixed concentration of 10 μg ml -1) indicates increase in membrane permeability of C. albicans cells treated with variable concentrations (i.e., 4, 8, 16, 32, 64 and 128 μg ml-1) of the exAFP-C28. (b) The exAFP-C28 at a concentration of 32 μg ml -1 has no hemolytic activity towards human RBCs compared to the negative (1% Triton X-100) and positive (PBS) controls with 30 min and 60 min of incubation. Data represent mean ± SD of triplicate experiments.

Mass Spectrometry and Proteomics 1 MARPDKAAAV AELADQFRSS NAAVLTEYRG LTVAQLKTLR RSLGEDAQYA 51 VVKNTLTKIA ANEAGINTLD DLFNGPTAVA FITGDPVVSA KGLRDFAKDN 101 PNLVIKGGVL DGKALSADEI KKLADLESRE VLLAKLAGAF KGKQSQAASL 151 FQALPSKFVR TAEALRAKKA EQGGAE Fig : (a) Results obtained from peptide mass fingerprinting followed by MASCOT search shows 5 peptide sequences have identical matching (in red bold) with several stretches of amino acid sequences of the 50S ribosomal protein L10 of Streptomyces avermitilis, and display 61% coverage. (b) Mass spectrometric result depicts the molecular mass of exAFP-C28 as 28.2 kDa. (c) Garnier Plot to determine the secondary structure of the protein indicated that amino acid residues of exAFP-C28 form around 62% helixes.

Bioinformatics Analysis Results Fig : (a) A superimposition of the Kyte-Doolittle Hydrophobicity plot and Hopp-Woods Hydrophilicity plot which indicate alternating hydrophobic and hydrophilic residue structures in exAFP-C28 (b) A plot of hydrophobic moments indicates strong hydrophobic moments in amino acid regions 90-95 and 120-130 which are alpha helixes, indicating amphipathic nature. (c) The homology model of exAFP-C28 generated from YASARA has 8 alpha helixes and 5 beta strands.

Discussion  The exAFP-C28 might be comprised of several more amino acids or modified post-translationally by covalent binding with some other biomolecules, as Mol. mass of S. avermitilis L10 protein (176 aa) is 18.54 kDa but Mol. Mass of exAFP-C28 is almost equal to 28 kDa.  Alternating hydrophobic and hydrophilic amino acid residues increases the probability of amphipathic nature in α-helixes, which provides the membrane permeability feature of exAFP-C28 (SEM).  Amino acid residues 90-95 and 120-130, regions which consist of helixes (Garnier Plot), have very large hydrophobic moments. Hence those α-helixes may have possible amphipathic nature.  N-terminal peptide derived from the 50S ribosomal protein L1 of Helicobacter pylori has cecropin-like antibacterial activity, and is also able to form perfect amphipathic helix, that is required for membrane penetration or destabilization.

Conclusion  The Colletotrichum sp. DM-06, an endophytic fungus of the medicinal herb Ocimum sanctum produces an extracellular antifungal protein of ~28 kDa, which is designated as exAFP-C28.  The morphological features and phylogentic analysis indicate that the endophyte fungal strain DM-06 is closely related to Colletotrichum gloeosporioides.  Through SEM and flow cytometry analyses, we have established that the exAFP-C28 protein destabilizes the cell membrane of the fungal pathogen C. albicans in a dose-dependent manner.  exAFP-C28 protein shows no cytotoxic effect on human red blood cells at a dose that is the MIC for the pathogenic C. albicans cells.

Add a comment

Related presentations

Related pages

Isolation, purification and characterization of ...

... Isolation, purification and characterization of ... purification and characterization of extracellular protease ... endophytic fungal ...
Read more

Isolation and Characterization of Saponin-Producing Fungal ...

Isolation and characterization of saponin-producing fungal endophytes from ... the representative isolate from ... of two endophytic fungal ...
Read more

Characterization of Antifungal Natural Products Isolated ...

The objectives of this study were to confirm the endophytic ... isolation of putative fungal ... Characterization of Antifungal ...
Read more

Antibacterial Activity of Extracellular Protease Isolated ...

The antibacterial activity of X. psidii KT30 extracellular protein ... Isolation, purification and characterization ... protein substrates. Fungal ...
Read more

Isolation and characterization of endophytic bacteria from ...

Isolation and characterization of endophytic bacteria from Plectranthus ... lipid transfer protein from pepper are ... from endophytic fungal ...
Read more

Isolation and characterization of plant growth promoting ...

... of plant growth promoting endophytic diazotrophic ... Characterization of endophytic ... on both fungal isolates. These antifungal ...
Read more

Endophytic fungal isolate mediated biosynthesis of silver ...

Endophytic fungal isolate mediated biosynthesis ... in the extracellular fungal filtrate could be ... and characterization of protein capped ...
Read more

3. Isolation of Endophytic Actinomycetes Using Surface ...

Isolation of Endophytic Actinomycetes Using Surface Sterilization Method and Selectively Isolation Media.
Read more