Internship presentation

50 %
50 %
Information about Internship presentation
Science

Published on April 5, 2014

Author: jordanspalding

Source: slideshare.net

Description

summary of research completed at Martinlab in 2013.

Preservation of mRNAs in Torpor for Brown Adipose Tissue Activity During Arousal JORDAN SPALDING BIOLOGY 3939 UNIVERSITY OF COLORADO DENVER AIMEE BERNARD, PhD Ictidomys tridecemlineatus Spalding Jordan, Grabek Katie, Martin Sandy

Main points • Squirrels, hibernation and BAT • Increase in abundance of transcripts • Is it transcription or preservation?

13 Lined Ground Squirrels (Ictidomys tridecemlineatus) [1] Squirrels and Hibernation*

Hibernation Heterothermy in Winter

Non-Shivering Thermogenesis Torpor/Arousal Cycles Hindle, A. (2013) Martinlab.

[iv]

Jastroch et al., Essays Biochem. (2010) 47: 53–67

Transcriptome Analysis [2] Increase in Abundance of Transcripts* Grabek, K. (2013). MartinLab -1.5 -1 -0.5 0 0.5 1 1.5 2 2.5 InterBout Arousal Late Torpor Early Arousal Spring Warm RelativeFoldChange 0 5 10 15 20 25 30 35 40 InterBout Arousal Late Torpor Early Arousal Spring Warm BotyTemp.ºC

How does transcript abundance increase in torpor?

Enriched for BAT activity Cluster Enrichment Score No. of Genes Mitochondrion 4.04 27 Neutral Lipid Biosynthetic Process 2.74 4 Lipid Catabolic Process 2.33 11 Adipocytokine Signaling Pathway 2.17 9 Glycerolipid Metabolic Process 2.14 12 Generation Of Precursor Metabolites And Energy 2.08 13 Tricarboxylic Acid Cycle 2.03 5 Lipid Droplet 1.93 3 Fatty Acid Metabolism 1.38 7 Grabek, K. (2013). MartinLabFurness, D. (2013) Keele University

Stabilized Transcription in torpor How can transcript abundance increase? [3] Is it transcription or preservation?*

The experimental approach Total RNA Design Primers qPCR total RNA Hybridize Oligo(dT)Make cDNA Clone Sequence Standard Curve Elute low salt Elute high salt qPCR long Poly(A) qPCR short poly(A) Compare + Analyze Compare to genome

Isolation and Sequencing JH393516.1 137554 to 137652 (+) [LIPE (intron)] TGGTGTCAAGCAGCCACAAA [LIPE_I8B_FOR primer] (aligned) AAGTTGGCCGAGCCTCCTGCTGTGGTCCAGGAGACAGCTGGAACAGGGCACCAAGCAT GGCAATAAAGCCTCATGCTGA [LIPE_I8B_REV primer] (aligned) GSR LIPE QRSL1 BTG2 Snora STAP2 CIDEC GAPDH Scarna OGDH

qPCR Lipe I8B cDNA

Results GSR LIPE QRSL1 BTG2 Snora STAP2 CIDEC GAPDH Scarna OGDH Transcripts with long Poly(A) tails are stable during torpor Transcripts lacking/with short poly(A) tails decrease in torpor Polyadenylation confers stability for select transcripts Lipe STAP2Snora44 scaRNA 9

0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 IBA LT E-Ar SpW STAP2 Percent of Total RNA Signal transduction 0 10 20 30 40 InterBout Arousal Late Torpor Early Arousal Spring Warm BotyTemp.ºC 0 10 20 30 40 InterBout Arousal Late Torpor Early Arousal Spring Warm BotyTemp.ºC Total RNA Long Actual Abundance Long 0 5 10 15 20 25 30 35 IBA LT E-Ar SpW PercentofTotalRNA(recovered)

Conclusion • Transcripts ‘increased’ in torpor by stabilization • Most transcripts degraded in torpor • Steady state decreases

Acknowledgements • I acknowledge support from the APS’s Integrative Organismal System Physiology Fellowship • Thank you to Sandy Martin for being an hands-on lab PI and persistent in developing my knowledge • Thank you to Katie Grabek for providing technical support and walking me through procedures • Thanks to Allyson Hindle for help with concepts and troubleshooting • Thanks to Greg Florant for administrative and technical support • Thanks to Vishnu Raman, Ross McNeill, Kelsi Grogan and Nico Roberts for being there for my ‘stupid’ questions.

Bibliography i. AMREI JÄNICKE, JOHN VANCUYLENBERG, PETER R. BOAG, ANA TRAVEN, and TRAUDE H. BEILHARZ. ePAT: A simple method to tag adenylated RNA to measure poly(A)-tail length and other 39 RACE applications. RNA. 2012; (18)6.p1-7. ii. Da Wei Huang,, Brad T Sherman, & Richard A Lempicki. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature Protocols. 2009; (4)1.p44-57 iii. Hedda A. Meijer, Martin Bushell, Kirsti Hill, Timothy W. Gant, Anne E. Willis, Peter Jones and Cornelia H. de Moor. A novel method for poly(A) fractionation reveals a large population of mRNAs with a short poly(A)tail in mammalian cells. Nucleic Acids Research. 2007;(35)19.p.1- 13. iv. Martin, Sandy. (2013) Research Strategy. p.1-17. v. michael a. frohman, michael k. dush, and gail r. martin. Rapid production of full-length cDNAs from rare transcripts: Amplificationusingasinglegene-specificoligonucleotideprimer. Proc. Nati.Acad. Sci. USA. 1988; (85) p8998-9002.

Add a comment

Related presentations

How organisms adapt and survive in different environment.

Aplicación de ANOVA de una vía, modelo efectos fijos, en el problema de una empres...

Teori pemetaan

Teori pemetaan

November 10, 2014

learning how to mapping

Libros: Dra. Elisa Bertha Velázquez Rodríguez

Materi pelatihan gis

Materi pelatihan gis

November 10, 2014

learning GIS

In this talk we describe how the Fourth Paradigm for Data-Intensive Research is pr...

Related pages

Internship Presentation - Scribd

Internship presentation on Young Innovations Pvt. Ltd Presented by: Sanam Shrestha 12-05-2011 Objectives of Internship General Objectives:
Read more

Final Internship presentation - Zayed University

Duaa Al Mehri Maryam Al Ansari w w w . d m i . a e Final Internship presentation College of Communication and Media Sciences
Read more

Internship Presentation by Yew Yao Qing on Prezi

My Internship Footprints Attachment to About Fairmont and Swissôtel The Stamford About Raffles City Convention Centre Organisation Structure of Sales ...
Read more

Internships – Internship Search and Intern Jobs ...

Find internships and employment opportunities in the largest internship marketplace. Search paid internships and part time jobs to help start your career.
Read more

Internship Presentation - scribd.com

Internship Presentation - Free download as Powerpoint Presentation (.ppt / .pptx), PDF File (.pdf), Text File (.txt) or view presentation slides online.
Read more

PowerPoint Presentation - Florida Institute of Technology

Internship Search & Issues Career Services & Student Employment * * Topics Covered Internships Defined Benefits Define Internship Goals Internship Search ...
Read more

Final Internship Presentation - YouTube

Kirsten Haugsted's Final Internship Presentation for Summer 2013 at Wilkinson & Associates ERA Powered Real Estate
Read more

Presentation Software | Online Presentation Tools | Prezi

Welcome to Prezi, the presentation software that uses motion, zoom, and spatial relationships to bring your ideas to life and make you a great presenter.
Read more