
Frame Shift Mutation

50 %
50 %
Information about Frame Shift Mutation

Published on November 26, 2008

Author: chhabra61



Slide 1: MUTATION ATTCCTACTGATCGTACAATAGACAGATTAAT ATTCCTACTGATCGCACAATAGACAGATTAAT Point Mutation Susceptible Resistant A useful procedure to produce a new trait But the normal gene is modified A transgene is not involved A product of mutagenesis is not GMO Gene Slide 2: MUTATION Frame Shift ATTCCTACTGATCGTACAATAGACAGATTA aa1 aa2 aa3 aa4 aa5 aa6 aa7 aa8 aa9 aa10 Protein 1 Protein 2 Protein 3 ATTCTACTGATCGTACAATAGACAGATTA aa1 aa* aa* aa4* aa* aa* aa* aa* aa* aa* Protein 4 Protein 5 Protein 6 Deletion, addition would lead to frame shift mutation Protein changes Substitution would not change much the composition of proteins

Add a comment

Related presentations

Related pages

Frameshift mutation - Wikipedia, the free encyclopedia

A frameshift mutation (also called a framing error or a reading frame shift) is a genetic mutation caused by indels (insertions or deletions) of a number ...
Read more

Frameshift – Wikipedia

Ein Frameshift oder Rasterschub beziehungsweise Leserasterverschiebung ist eine besondere Art der Mutation. Es handelt sich um eine Verschiebung des ...
Read more

frameshift mutation / frame-shift mutation; frameshift ...

A frameshift mutation is a genetic mutation caused by a deletion or insertion in a DNA sequence that shifts the way the sequence is read. A DNA sequence is ...
Read more

Frameshift mutation - Biology-Online Dictionary

Please contribute to this project, if you have more information about this term feel free to edit this page.
Read more

Frameshift mutation - definition of frameshift mutation by ...

frame·shift mutation (frām′shĭft′) n. A mutation in a DNA chain that occurs when the number of nucleotides inserted or deleted is not a multiple of ...
Read more

Mutation - Guido Bauersachs

Einführung zum Thema Mutation, ... Solche Mutationen, die Raster-Mutationen (Rasterschub-Mutationen, Frameshift-Mutationen) genannt werden, ...
Read more

frameshift mutation - The Free Dictionary

frame·shift mutation (frām′shĭft′) n. A mutation in a DNA chain that occurs when the number of nucleotides inserted or deleted is not a multiple of ...
Read more

Translational frameshift - Wikipedia, the free encyclopedia

Translational frameshift Translational frameshifting or ribosomal frameshifting refers to an ... Frameshift mutation; HIV Ribosomal frameshift signal;
Read more

Frameshift-Mutation - DocCheck Flexikon

1 Definition. Eine Frameshift-Mutation ist eine Mutation, die eine Verschiebung des Leserasters von Genen auf der DNA verursacht. 2 Hintergrund. Da der ...
Read more

Genmutation - DocCheck Flexikon

1 Definition. Eine Genmutation ist eine Form der Mutation, die durch eine Änderung der Nukleotidsequenz der Gene entsteht. Sie tritt ein, wenn eine ...
Read more