dogclark

100 %
0 %
Information about dogclark
Entertainment

Published on November 16, 2007

Author: Danior

Source: authorstream.com

The Amazingly Similar Genes of Dogs, Humans, and Mice:  The Amazingly Similar Genes of Dogs, Humans, and Mice Andrew G. Clark and Stacey L. Hubbell Institute of Molecular Evolutionary Genetics Department of Biology Penn State University Motivation for dog genomic analysis:  Motivation for dog genomic analysis Our acute awareness of dog phenotypes. Model for cardiac physiology. Depth of knowledge of nutrition. Genetic partitioning by breeds. Extensive documentation of behavioral, phenotypic, and morphological variation among breeds. Human and dog chromosome maps line up well. DNA sequence similarity to human. Wide diversity of forms of the domestic dog:  Wide diversity of forms of the domestic dog Human Diseases with Dog Equivalents (selections from a list of more than 350):  Human Diseases with Dog Equivalents (selections from a list of more than 350) Milroy’s disease Endocardial fibroelastosis Congestive heart failure Hyperadrenocorticism Hyperinsulinism Achalasia Ulcerative colitis Pacreatitis Hepatorenal syndrome Von Gierke’s syndrome Cyclic neutropenia Multiple myeloma Hemophilia Factor VII deficiency Christmas disease Globoid leukodystrophy Familial amaurotic idiocy Neurogenic muscular cramps Hypoplasia of organ of Corti Retinal dysplasia Diabetic microaneurysms Prostatitis Hecht’s pneumonia Osteogenesis imperfecti Disk luxation Acetabular dysplasia Ehlers-Danlos disease Seborrheic dermatitis Impetigo Uremia Slide6:  Gray Wolf Canis lupus lycaon Slide8:  Sequences of mitochondrial DNA show that dogs and wolves have often interbred. Vila et al. 1997. Science 276:1687-1689. Slide9:  "I have two wolf-dogs I take everywhere. I never fail to hear how they are the best-behaved animals ever seen. My dogs come when they are called. They also sit, stay and heel as well, with or without a leash. They both get along well with neighbors' ducks, geese, goats and horses. I throw large summer parties and my hybrids mingle among the guests and their children.” A wolf-dog hybrid owner says: The power of mouse genetics:  The power of mouse genetics Rich history as a model organism Huge knowledge base of human- mouse gene matches. Complex disorders: diabetes, hypertension, obesity 6992 mapped protein genes 7377 mapped microsatellites Gene knockout technology Human Diseases with Mouse Equivalents:  Human Diseases with Mouse Equivalents Hypertension Thyrotropin deficiency Obesity Megacolon Niemann-Pick disease tumors Macrocytic anemia Prenatal muscle degeneration Dystrophy of white matter Cochlear degeneration Pigmented retina Uterine cystic hyperplasia Lung tumors Senile osteoporosis Clubfoot Albinism Diabetes insipidus Renal amyloidosis Slide12:  Homology: similar form due to common ancestry Phylogenetic relationships:  Phylogenetic relationships Homo sapiens Mus musculus Canis lupus familiaris Molecular Clock Estimates Human-dog split ~83 MYA Human-mouse split ~112 MYA (Kumar and Hedges 1998 Nature 392:917-920) (O’Brien et al. 1999 Science 286:458-481) Our study plan:  Our study plan Retrieve all complete dog gene sequences (n = 254). Find human and mouse homologous genes with BLAST. Align the dog-human-mouse sequences. Calculate sequence divergence and interpret the meaning quantitatively. Slide15:  blast_tmp 241 ttgccaagccctgtcggagatgatccagttttacttggaggaggtgatgccccgggctga 300 dog U39569 237 ..........t....c.................t...................a...... 296 U38200 237 ..........t.......................c..................a...... 296 AF060520 237 ..........t....c.................t...................a...... 296 L26029 244 ..........t....t..................c..................aa..... 303 AB000514 237 ..........t....t..................c..................aa..... 296 L26031 244 ..........t....t..................c..................aa..... 303 L26030 244 ..........t....t..................c..................aa..... 303 M57627 267 ..........t....t..................c..................aa..... 326 human U11767 240 ..........t.......a...............c................a.a...... 299 AF043333 183 ..........t....t..................c..................aa..... 242 U11421 255 ..........t.......a...............c................a.a...... 314 Z29362 308 ..........t.......a...............c................a.a...... 367 U00799 237 ..........t.......a...............c....a...........a.a...... 296 AF088887 237 a.........t.......................c..a....c........g.aa..... 296 AF068058 283 a.........t.......................c..a....c........g.aa..... 342 AF012909 303 ..........t.......................c.a.t..............a...a.. 362 U93260 293 ..........t.......................c.a..............gaa...... 352 L37781 305 ..........t.a..a..a...............c...ta..a..........a...a.. 364 NM_010548 312 ..........t.a.....a...............c...ta..a..........a...a.. 371 mouse L02926 238 ..........t....a..a......a........c...ta..a..........a...a.. 297 NM_012854 281 ..........t....a..a......a........c...ta..a..........a...a.. 340 X60675 281 ..........t....a..a......a........c...ta..a..........a...a.. 340 AF097510 302 ............a.....a...............c...ta..a..........a...a.. 361 AF054604 129 ......t...t....c.................t...................a...... 188 Non-automatable aspects:  Non-automatable aspects Checking gene families Gene redundancies Sequencing errors Files containing introns Mitochondrial DNA Slide17:  The Central Dogma DNA makes RNA makes protein. Slide18:  Coding amino acids from RNA Slide19:  The Genetic Code Slide20:  Silent site: a letter in the DNA code that can be changed without changing the protein encoded by the gene (also called “synonymous”) ps : proportion of silent sites that have changed Some definitions Slide21:  Mis-sense mutation: an altered letter in the DNA code that changes the amino acid sequence of the protein encoded by the gene (also called “nonsynonymous”). pn : proportion of mis-sense sites that have changed. Slide22:  Most genes show much higher levels of silent divergence Slide23:  Ratios of mis-sense to silent rates r = 0.933 Genes with excess mis-sense divergence:  Genes with excess mis-sense divergence IDUA - a-L-iduronidase CLN2 - pepstatin-insensitive lysosomal protease NOS - nitric oxide synthase CD34 - hematopoietic progenitor cell marker PTH1 - parathyroid hormone receptor-1 MMAC1 - mutated in multiple advanced cancers GHR - growth hormone receptor Slide25:  human dog mouse 14448 7062 7902 Inferred locations of substitutions on the tree Relative rates tests for silent and mis-sense sites:  Relative rates tests for silent and mis-sense sites Growth hormone receptor silent mis-sense dog 40 16 human 27 43 X2 = 13.49*** Translation: GH receptor gene is evolving way too fast in humans ! Slide27:  Unusually highly conserved genes tend to code for very basal functions GAq GTP-binding protein alpha 2 0.000000 rab2 GTP-binding protein (rab2) 0.000000 SPC22 microsomal signal peptidase 0.000000 SPC18 microsomal signal peptidase 0.000000 Sec61-B protein translocation complex 0.000000 tektin tektin (sperm development) 0.000000 centractin centractin (microtubule org.) 0.001379 rab7 GTP-binding protein (rab7) 0.002494 mitogen mitogen activated protein kinase 0.002920 ubiquitin ubiquitin-tagged degradation 0.004032 Kv3.1 Kv3.1 potassium channel 0.005252 fosB fosB transcription factor 0.006070 Slide28:  The X chromosome of humans and cats has the same gene order!! Conclusions:  Conclusions Almost all human genes can be lined up unmistakably to genes in dogs, with an average mis-sense divergence of 7.5%. By having three species with aligned genes, we can do branch-specific inferences. The lineage to dog has faster silent rate relative to the lineage to humans … but the human branch has an elevated mis-sense rate. Several genes with elevated mis-sense rates suggest that evolution is driving these genes along at a faster rate than others. Some dog websites:  Some dog websites www.rufruf.com www.purina.com www.pfizer.com www.petnet.com www.petwellness.com/doghome.asp www.vgl.ucdavis.edu/research/canine/ www4.ncbi.nlm.nih.gov/PubMed/

Add a comment

Related presentations

Related pages

Coastal German Shepherd Rescue - Clark Kent

If you would like to meet Clark Kent, please complete the online application and an adoption counselor will contact you.
Read more

my dog clark - YouTube

it was lewis and clark grandsons of boone and crooket, lewis got hit buy a car as a pup clark is 10 years old he is a great dog.
Read more

Anthony "Swamp Dog" Clark | ReverbNation

Blues music, lyrics, and videos from Upper Marlboro, MD on ReverbNation
Read more

Anthony Swamp Dog Clark Music | Blues With A Funk Edge

Download 2 of his hit singles for free. Listen to what others are saying about Anthony Swamp Dog Clark! It is not long after the music starts, that the ...
Read more

Anthony Swamp Dog Clark

2015 Winner Of The Central Delaware Blues Society Battle Of The Blues Bands 2010 Winner of the Washington DC Battle Of The Blues Bands 2011 International ...
Read more

Clark Dogs - Hot Dog - Main St - Sarasota, FL, Vereinigte ...

Clark Dogs in Sarasota mit Beiträgen von Menschen, wie du und ich. Mit Yelp kannst du suchen, Empfehlungen teilen und dich mit anderen darüber ...
Read more

Anthony Swampdog Clark Chameleon - YouTube

Filmed courtesy of Black Betty of Moonshine Society. Band consists of Rodney Dunton drums, John Bell guitar, Joe Poppen guitar, Royce ...
Read more

Clark Street Dog - Chicago, IL - Hot Dogs|Burgers

Clark Street Dog. Clark St. Dog has been serving the Chicagoland area delicious Chicago style food since 1977. Hot Dogs, Gyros, Italian Beef, Philly Steaks ...
Read more

Anthony "Swamp Dog" Clark

Members: Andy Hamburger drums, Chuck Carter bass, John Bell guitar, Rick Jones Keyboards, Anthony "Swamp Dog" Clark harp
Read more

Tim The Dog Clark | LinkedIn

View Tim The Dog Clark’s professional profile on LinkedIn. LinkedIn is the world's largest business network, helping professionals like Tim The Dog Clark ...
Read more