Diversity of Crinkler Effector Genes in Phytophthora infestans isolates.

67 %
33 %
Information about Diversity of Crinkler Effector Genes in Phytophthora infestans isolates.
Data & Analytics

Published on May 7, 2014

Author: gjetherington

Source: slideshare.net

Description

My talk given at Microbes in Norwich 2013

Diversity of Crinkler Effector Genes in Phytophthora infestans isolates. Graham Etherington 8 Feb 2013

Outline • Phytophthora infestans – Biology and evolution – Effector genes • Crinklers – Gene architecture – VLVVVP recombination motif • Aims • Methods – Looking for the VLVVVP motif – Making use of all the data • Applying methods to data • Confirming results • Comments/To-do

Phytophthora infestans • Oomycete • Cause of Late Blight in Solanum species (e.g. Potato) • Responsible for the Irish Potato Famine (1845) • Global potato yield losses of 16% • Economic losses of £4.3 billion annually

• Capable of sexual and asexual reproduction • High evolutionary potential - striking capacity for genetic change - rapidly adapts to overcome resistant plants • Phytophthora - from Greek (phytón) “plant” and (phthorá) “destruction” - the plant-destroyer! Phytophthora infestans

P. infestans effector genes • Secreted from pathogen – alters host to enable infection • High polymorphism and positive selection • Forms a ‘haustorium’ which delivers effector molecules to plant cells. • Two main cytoplasmic effectors: – RXLRs – Crinklers Beynon 2006

Crinkler effector genes Haas 2009 Conserved N-terminal Diverse C-terminal Torto 2003

Crinklers N-terminal C-terminal Recombination hotspot. Look at sequence diversity around this site. Roman Numerals: V+L+V+V+V=70 =70P

Aims • Do P.infestans isolates contain unique Crinkler genes? • What is the diversity of Crinklers within P.infestans? • How many Crinklers are shared between different isolates?

The data • 76nt PE Illumina genomic sequences of P. infestans isolates – EC3527 (51x) – EC3626 (64x) – UK 3928 (50x) – US 22 (50x) – NL 07434 (50x) Test data (99% seq similarity)

Looking for VLVVVP in genome • Take isolate reads, make 6-frame translations and look for ‘VLVVVP’ recombination site? • Control experiment – available resources: – P. infestans reference sequence (T30-4) – All annotated transcripts • including Crinklers • Make 6-frame translation of genome and look for VLVVVP motif – Where are the motif hits?

Looking for VLVVVP in genome • 231 VLVVVP hits: – 81 in annotated Crinklers – 18 in other transcripts – 132 outside any annotated feature • Conclusion: Looking for the VLVVVP motif in 6- frame translations results in a very high number of false positives.

DNA sequence • Extract Crinkler gene sequences using P. infestans annotation. • Align sequences • Locate VLVVVP motif coding sequence • Create ‘variable consensus’ DNA sequence from alignment.

Consensus sequence Consensus sequence logo GTGCTGGTGG[TC]G[TG]T[TG]CC V L V V V P

Testing the consensus sequence • No. of consensus motifs found in P. infestans genome: 194 – in annotated Crinklers: 185 – in any other annotated genes: 0 – not found in any annotated region: 9 • Blast 300nt upstream region – 8 Crinkler gene hits, 1 false positive • 193/194 hits were Crinklers • Conclusion: Looking for the ‘variable consensus’ sequence in reads should result in very low number of false positives.

Methods • Search reads for variable consensus. • Truncate reads at consensus. – ATCGGTTCATGTGCTGGTGGTGTTTCCGCCGTG becomes GTGCTGGTGGTGTTTCCGCCGTG • Count the occurrence of each sequence: GTGCTGGTGGTGGTTCCGCCGTG 100 GTGCTGGTGGCGTTGCCATGTG 70 GTGCTGGTGGCGTTGCCA 5 GTGCTGGTGGCGTTGCCCGCGTG 1 GTGCTGGTGGTGGTTCCGCC 30 • Remove singletons

Making use of all the data • In the datasets there are read-counts for short ‘sub- sequences’ which are part of one or more longer unique ‘super-sequences’. GTGCTGGTGGTGGTTCCGCCGTG 2 GTGCTGGTGGTGGTTCC 8 GTGCTGGTGGT 55 GTGCTGGTGGTTAACGGT 40 GTGCTGGTGGTTAACGGTACGTAA 25 • Interested in the longest unique super-sequences, but don’t want to throw away information in the shorter sub-sequences.

Proportional Representation • Distribute read counts of smaller sub- sequences to longer super-sequences proportionately: – assign more read counts to common super- sequences – assign less read counts to rarer super-sequences

Proportional Representation A ABCDE 100 Bi ABCDEFGH 144 Bii ABCDEFGA 6 A ABCDE 100 Bi ABCDEFGH 48 Bii ABCDEFGA 2 100 50 48 96 100 50 2 4 sub-sequence A ABCDE 100 super-sequence Bi ABCDEFGH 48 super-sequence Bii ABCDEFGA 2 Sub-sequence A is shared between super-sequences Bi and Bii as follows: 50 Assign to Bi Assign to Bii +48 +2

Recap • Identify the best way to find Crinkler recombination motif (VLVVVP) in P. infestans = variable consensus sequence. • Search for the variable consensus in the isolate reads. • Create ‘proportionally representative’ longest super-sequences. • Produce Venn Diagram of shared and unique sequences (both as DNA seqs and protein seqs).

EC Crinklers As amino acid sequences Shared by both 59 ec3626 only 4 ec3527 only 1 Total 64 motif ec3527 ec3626 VLVALPPGTSSAPISDGSDFWLS 56 22 VLVALPPGTSSAPISDGTCRDFN 15 16 VLVALPPGTSSAPISDGTDFWLSRF 216 106 VLVALPPGTSSAPISDGTDLWLSRF 1103 899 VLVALPPGTSSAQ*AREQVCSSTRH 11 13 VLVALPPWTSSAPISDGTNLWLSRF 100 81 VLVALPSGTSSAPISDGTDLWLSRF 58 40 VLVVVPDEAGGAVASVEPS 11 18 VLVVVPDEAGGAVASVV 11 7 VLVVVPDGAGGSASDTSRIDR 2 8 VLVVVPDGAGGSASDTSRMDRLFDK 322 413 VLVVVPDVAGYAVASVELSAAPTT 22 21 VLVVVPDVAGYAVASVEPSAAPTTI 13 25 VLVVVPE*EQPVSPPQKN*SAVST 36 41 VLVVVPEGAGGDLELASLLSTTIQ 19 32 VLVVVPEGAVGSALSQPANSATIPN 20 15 VLVVVPEGGKRHPSNGWFAEFFH 17 24 VLVVVPEHDGAISNDMSAVTTP 49 66 VLVVVPEHDGTISNDMSAVTTPLIV 99 49 VLVVVPEHDGTISNDMSAVTTPLT 25 25 VLVVVPEITTTV*VRERKDEVLMA 50 14 VLVVVPEQAQGQPGLWLVTGSVD 19 25 VLVVVPEQDGKIKRYVCSDNATDSR 147 95 VLVVVPEQDGTISKEMFAATTPLT 91 55 VLVVVPEQDGTISKEMSAATSPLTV 28 11 VLVVVPEQDGTISKEMSAATTPLTL 57 55 VLVVVPEQDGTISKEMSAATTPLTV 654 437 VLVVVPEQDGTISNDLSAVTTPLTV 4 28 VLVVVPEQDGTISNDMSAVTTPLTV 605 463 VLVVVPEQGFSVPTVSQDGVFDHCI 36 41 VLVVVPEQGSSVL*TVFSTTAVIHS 24 34 VLVVVPEQGSSVPTVSLDGVFDHCS 58 96 motif ec3527 ec3626 VLVVVPEQGSSVPTVSQDGVFDHCI 136 249 VLVVVPEQGSSVPTVSQDGVFDHCS 61 82 VLVVVPESFGVDSQLLQLQEALLQ 29 17 VLVVVPGIITTVEVRERKDDKLIMA 25 52 VLVVVPGITTTVEVRERKDEMLMA 45 10 VLVVVPGITTTVEVRERKDEVLMAE 173 251 VLVVVPGLVASTVTIVIEEAAGSKP 110 126 VLVVVPGQGSSVPTVSQDGVFDH 14 5 VLVVVPGQRLPIAATAIHEPHPA 14 34 VLVVVPKGKNDRSAAMAIGVAPSLP 227 379 VLVVVPKGRNDRSAAMAIGVAP 5 10 VLVVVPKQDGTISNDTSAATTPLT 39 28 VLVVVPKQGTSVPTVSQDGVFDHCN 12 48 VLVVVPMPSVGSKRSADEIADVQKR 21 29 VLVVVPPPSVGSKRSADEIADVQK 13 17 VLVVVPPQDDLRSPAMTLLEAILPY 22 25 VLVVVPRSRETMTHGAQWILR 20 8 VLVVVPRSRETTTHGALWILRFN 16 9 VLVVVPRSTGDDDAWSPKDLCTVD 27 40 VLVVVPRSTGDDDAWSPMDPKVQLN 695 699 VLVVVPRSTGDDDAWSPMDSK 3 44 VLVVVPRSTGDDYALSPNDLCTLDP 28 50 VLVVVPRSTGDGDAWSPMDPKVQLN 29 25 VLVVVPRVAPAPENKRKRKRMEDED 37 24 VLVVVPSDDVVVPVSVPVAVPTGPE 25 39 VLVVVPVGAGVGVGQDVSMDVPAA 83 141 VLVVVPVGAGVGVGQDVSMHVPAAV 7 8 VLVVVPGLVASTVTIVIEEAAES 0 43 VLVVVPRSAGDDDAWS 0 5 VLVVVPYGAG 0 3 VLVVVPYPEQ 0 9 VLVALPPGKS 2 0

Proportional representation of all DNA super-sequences. Shared and unique motifs Number in brackets refers to percent of dataset. …as amino acid sequences

UK/US/NL isolate Crinklers motif uk us nl VLVALPPGTSSAPISDGSDFWLSR 12 26 37 VLVALPPGTSSAPISDGTCRDFNI 28 72 47 VLVALPPGTSSAPISDGTDFWLSRF 119 259 198 VLVALPPGTSSAPISDGTDLWLSRF 860 1352 1336 VLVALPPWTSSAPISDGTNLWLSRF 101 143 232 VLVALPSGTSSAPISDGTDLWLSRF 10 105 17 VLVVVPDEAGGAVASVEPSAAPT 5 26 145 VLVVVPDGAGGSASDTSRMDRLFDK 147 347 399 VLVVVPE*EQPVSPPQKN*S 3 16 17 VLVVVPEGAGGDLELASLLSTTIQE 12 18 50 VLVVVPEGAVGSALSQPANSATI 15 49 37 VLVVVPEGGKRHPSNGWFAEFFHP 12 55 79 VLVVVPEHDGAISNDMSAVTTPLTV 18 55 53 VLVVVPEHDGTISNDMSAVTTPLIV 42 116 157 VLVVVPEITTTV*VRERKDEVLM 3 94 29 VLVVVPEQAQGQPGLWLVTG 6 18 34 VLVVVPEQDGKIKRYVCSDNATDSR 78 150 154 VLVVVPEQDGTISKEMFAATTPLTL 16 165 49 VLVVVPEQDGTISKEMSAATSPLT 63 34 18 VLVVVPEQDGTISKEMSAATTPLTV 252 895 793 VLVVVPEQDGTISNDLSAVTTPLTV 16 6 57 VLVVVPEQDGTISNDMSAVTTPLTV 307 902 619 VLVVVPEQGFSVPTVSQDGVFDHCI 15 28 17 VLVVVPEQGSSVL*TVFSTTAVIHS 18 8 38 VLVVVPEQGSSVPTVSQDGVFDHCI 71 255 283 VLVVVPEQGSSVPTVSQDGVFDHCS 71 106 14 VLVVVPESFGVDSQLLQLQEALLQ 10 52 26 VLVVVPGITTTVEVRERKDEVLMAE 60 453 353 VLVVVPGLVASTVTIVIEEAAG 34 85 103 motif uk us nl VLVVVPKGKNDRSAAMAIGVAPSLP 147 333 173 VLVVVPKQDGTISNDTSAATTPLT 7 24 77 VLVVVPKQGTSVPTVSQDGVFDHC 2 44 25 VLVVVPMPSVGSKRSADEIADVQ 3 10 21 VLVVVPPPSVGSKR 9 22 15 VLVVVPPQDDLRSPAMTLLEAILPY 21 27 20 VLVVVPRSAGDDDAWSPMD 3 8 17 VLVVVPRSRETMTHGAQWILRFN 9 17 62 VLVVVPRSRETTTHGAL 4 9 4 VLVVVPRSTGDDDAWSPKDLCTVDP 12 104 133 VLVVVPRSTGDDDAWSPMDPD 12 52 11 VLVVVPRSTGDDDAWSPMDPKVQLN 101 364 262 VLVVVPRSTGDDYALSPNDLCTLD 33 18 25 VLVVVPRSTGDGDAWSPMDPK 14 11 6 VLVVVPRVAPAPENKRKRKRME 4 19 21 VLVVVPSDDVVVPVSVPVAVPT 9 11 20 VLVVVPVGAGVGVGQDVSMDVPAAV 82 211 130 VLVVVPDQTEDANLSQRFSDL 3 42 0 VLVVVPDVAGYAVASVEP 0 20 18 VLVVVPEQGSSVPTVSLDGVFDHCS 0 81 72 VLVVVPGIITTVEVRERKDDKLIMA 0 30 36 VLVVVPGITTTVEVRERKDEMLMA 0 49 20 VLVVVPGQRLPIAATAIHEPH 0 27 22 VLVVVPDVDGYAV 8 0 0 VLVVVPGQGSSVP 5 0 0 VLVVVPEQDGEIKRYVCSDSAT 0 3 0 VLVVVPGIKTTVEVRERKDEVLMA 0 9 0 VLVALPPGTSKIGR 0 0 3 VLVVVPSPSVGS 0 0 10 VLVVVPYPEQAQVDMVHE 0 0 16 Shared by all 46 UK/US 1 US/NL 5 UK only 2 US only 2 NL only 3 Total 59

• UK 3928, US 22, NL 07434 Proportional representation of all DNA super-sequences ..as amino acid sequences Shared and unique motifs

Are Crinklers being correctly identified? Left paired-read = Left primer Right paired-read = Right primer • Create primers from reads for sequencing VLVVVP

Shared by NL/US Shared by UK/US NL US CRN PITG_12090 CRN PITG_12094 UK US CRN PITG_19373 CRN11 Crinklers correctly identified?

Results • EC data – reflects the similarity of the two isolates (99% identical at amino acid level). – from the 64 longest unique sequences, 59 are found in both isolates. – at least one isolate has unique Crinklers. • UK/US/NL data – Most Crinklers are shared – US genotype shares Crinklers with UK and NL, but very few shared between UK and NL – each isolate has 2-3 unique Crinklers.

Results • EC v UK/US/NL – 64 Crinklers in EC, 59 in UK/US/NL • 52 shared by both • 12 exclusive to EC isolates, • 7 exclusive to UK/US/NL • ‘VLVVVP’ not the only recombination motif. – ‘VLVALP’ is also found in 8/64 in EC super- sequences and 7/59 in UK/US/NL data.

Conclusions • Variable consensus sequence • ‘Proportional representation’ – identifies Crinkler diversity – estimates abundance. • P.infestans isolates do contain ‘unique’ Crinklers. – Present in a few or totally unique? • Application of methods on UK/US/NL data reflects the greater sequence diversity between the data. • Crinklers prediction verified through sequencing.

Comments • Method could bias the isolate with the most reads – normalisation. • Method shows diversity at the start of the recombination hotspot – can’t say much about the rest of the gene. VLVVVPEQDGTISNDMSAVTTPLTV 1000 VLVVVPEQDGTISNDMSAVTTPLTVABCDEFG 250 VLVVVPEQDGTISNDMSAVTTPLTVHIJKLMN 250 VLVVVPEQDGTISNDMSAVTTPLTVOPQRST 200 VLVVVPEQDGTISNDMSAVTTPLTVUVWXYZ 300

• To-do: – Larger-scale PCR/sequencing to confirm shared/unique Crinklers in isolates. – What would we find with longer (targeted?) sequences?

Acknowledgments • Kamoun Group – Sophien Kamoun – Kentaro Yoshida – Marina País – Liliana Cano • Dan MacLean

Add a comment

Related presentations

Research/ Dissertation on “How online selling has changed the marketing perspectiv...

مشروع قانون يتعلق بالقضاء على كل أشكال العنف ضد المرأة

Remedial geo

Remedial geo

November 6, 2014

nnn

This brief examines 2013 demographic data recently released by the U.S. Census Bur...

Introduction into Big data

Introduction into Big data

October 22, 2014

This presentation shows you the advantages and the importance of Big Data in these...

Info om powerpoint

Info om powerpoint

November 10, 2014

Powerpoint

Related pages

Academia.edu | Documents in Phytophthora infestans ...

Phytophthora infestans is ... effector protein genes in two isolates ... each containing different mitochondrial haplotypes and revealed diversity in ...
Read more

Diversity of Crinkler Effector Genes in Phytophthora ...

1.Diversity of Crinkler Effector Genes in Phytophthora infestans isolates. Graham Etherington 8 Feb 2013 . 2. Outline • Phytophthora infestans ...
Read more

Evidence for small RNAs homologous to effector-encoding ...

... effector-encoding genes and transposable elements in the oomycete Phytophthora infestans. ... RxLR and Crinkler (CRN) effector protein genes in two ...
Read more

Evidence for Small RNAs Homologous to Effector- Encoding ...

Oomycete Phytophthora infestans ... and Crinkler (CRN) effector protein genes in two isolates ... isolates. The P. infestans genome is rich in ...
Read more

Evidence for Small RNAs Homologous to Effector-Encoding ...

... Elements in the Oomycete Phytophthora infestans. ... RxLR and Crinkler (CRN) effector protein genes in ... isolates of Phytophthora infestans, ...
Read more

Phytophthora infestans - Springer

... information about effector diversity in P. infestans can ... Phytophthora infestans isolates ... of Phytophthora infestans genes ...
Read more

Evidence for Small RNAs Homologous to Effector-Encoding ...

... RxLR and Crinkler (CRN) effector protein genes in two ... effector genes in R0 and 3928A isolates. ... Phytophthora infestans effector AVR3a ...
Read more

Phenotypic Diversification Is Associated with Host ...

isolates is associated with the ... Hu¨berli D, Rizzo DM, et al. (2012) Phenotypic Diversification Is Associated with ... and effector genes in ...
Read more

Evolution and Management of the Irish Potato Famine ...

... CRN effector genes from the P. infestans genome ... of Phytophthora infestans isolates in ... Irish potato famine pathogen Phytophthora ...
Read more