Descubriendo el origen de la levadura lager

47 %
53 %
Information about Descubriendo el origen de la levadura lager
Food

Published on November 10, 2014

Author: FernandoDiMarco

Source: slideshare.net

Description

Descubriendo el origen de la levadura Lager: Implicancias y oportunidades para la industria cervecera nacional.

Material del curso Manejo de Levaduras de uso cervecero dictado en el Ministerio de Agricultura, Ganadería y Pesca de la Nación (MAGyP).

Por Diego Libkind (Laboratorio de Microbiologia Aplicada y BiotecnologíaInstituto de Investigaciones en Biodiversidad y Medioambiente (INIBIOMA), CONICET - UNComahue, Bariloche, Argentina)

1. Descubriendo el origen de la levadura Lager: Implicancias y oportunidades para la industria cervecera nacional Diego Libkind Laboratorio de Microbiologia Aplicada y Biotecnología Instituto de Investigaciones en Biodiversidad y Medioambiente (INIBIOMA), CONICET-UNComahue, Bariloche, Argentina.

2. Estructura charla Origen de la cerveza Lager Levadura Lager Descubrimiento de S. eubayanus Mapa genómico de levaduras cerveceras Biogeografía y genética poblacional Propiedades de fermentación Comentarios finales

3. Origen del proceso Lager, Cerveza Lager, y levadura Lager Aislamiento de cepa LAGER pura y distribución en principales cervecerías. Inicio producción cerveza Lager. S. cerevisiae +S. uvarum? +S. kudriavzevii? ~1500 1883 DOMESTICATION Proceso evolutivo influenciado por los humanos para satisfacer Proto-Lager Levadura ? Saccharomyces adaptada al Frio Levadura Lager S. pastorianus sus necesidades. Levadura Híbrida (Allopoliploide)

4. Saccharomyces salvajes?, donde están? Jose Paulo Sampaio (Portugal) S. uvarum S. uvarum S. kudriavzevii Corteza y suelo de Robles S. kudriavzevii S. cerevisiae S. paradoxus ? ¿Saccharomyces psicrófilas en Hemisferio sur? S. cerevisiae S. paradoxus

5. De Zhang et al., 2010 Saccharomyces en corteza? Corteza Roble (NZ) Sexualidad

6. Cyttaria hariotii Cyttaria espinosae Buscando Saccharomyces en Patagonia Sustrato de 3 especies de Nothofagus : - Hongo Cyttaria (Llao-llao) - Corteza - Suelo -Hongo parásito exclusivo, exclusivo de Nothofagus. -Estroma rico en azúcares, 10% azúcares simples. -Fermentación espontánea (levaduras). -Usado por aborígenes nativos para producir bebida alcóholica (chicha).

7. Bariloche, Patagonia, Argentina Nothofagus trees

8. Resultados de la búsqueda en hemisferio sur S. uvarum S. uvarum S. kudriavzevii Corteza, suelo y Cyttaria en Nothofagus S. kudriavzevii S. uvarum S. bayanus? S. uvarum Jose Paulo Sampaio (Portugal) S. cerevisiae S. paradoxus S. cerevisiae S. paradoxus

9. Descubriendo el progenitor faltante de la levadura Lager Es S. eubayanus el progenitor faltante? Secuencia genómica usando Next Generation Sequencing Technology (Illumina GAII, 36bp single-paired end, 13x cobertura). S. eubayanus S. pastorianus Levadura Lager W34/70 …ATGCCTGATTTCTTTAATTGGGCCTAATCATC… S. eubayanus 99,5 % homology …ATGCCTGATGTCTTTAATTGTGCCTATTCATC… …AGGGCCTTGATATGTGATTGTGTTTATTCATC… Dr. Chris Hittinger Universidad de Wisconsin Genoma no S. cerevisiae S. cerevisiae S. eubayanus es el progenitor faltante de la levadura Lager Madison, EEUU

10. Levadura Lager: un caso único de microbio domesticado Especie Parental DOMESTICATION Proto-lager Domesticación Levadura Lager Estudios de genómica comparativa permitirán la detección de cambios genéticos específicos relacionados con la adaptación al ambiente cervecero. Desarrollo de cepas Ale Lager

11. Evidencias de domesticación Metabolismo de la maltosa Isomaltosa (gen IMA1): relacionada con el corte de la maltosa. Duplicación e inserción de genes de S. cerevisiae en porciones de ADN de S. eubayanus. Metabolismo del Sulfito Transportadores de sulfato (genes SUL1 y SUL2): relacionados con el ingreso del sulfato, precursor del sulfito, en el interior de la célula. Inactivación del gen SUL1 (menos eficiente), y solo queda SUL2 (más eficiente). Fermentación de la maltosa mejorada Mayor producción de Sulfitos Transportador:

12. / S. cerevisiae ALE S. uvarum S. eubayanus LAGER / / ? / S. bayanus (Suva + Seub + Scer) / S. pastorianus (Seub + Scer) Especies Biológicas Cepas híbridas RESULTADOS: Definiciones taxonómicas Ale Lager

13. Mapa genómico de las cepas cerveceras y especies relacionadas Algunas cepas Ale Belgas? S. cerevisiae (Dunn & Sherlock, 2008) S. pastorianus S. kudriavzevii (Gonzalez et al., 2008; unpublished) S. eubayanus S. uvarum S. bayanus Belgian Grupo 1 (Saaz) Grupo 2 (Frobergh) CBS 380T NBRC 1948 (Libkind et al., 2011) ? Cepas ALE ¿Especie genéticamente diversa?

14. Muestreo adicional en Patagonia (Argentina) Nahuel Huapi Perito Moreno Glaciares Alerces

15. Biogeografía y genómica poblacional Patagonia - Lager Patagonia LAGERS (ambos grupos) S. eubayanus S. eubayanus presenta alta diversidad genética (~1%), y un a gran abundancia en Patagonia lo que sugiere que es una especie establecida en la región hace mucho tiempo. Cepa tipo La/s hibridización/es ocurrieron con un pool genético muy pequeño de S. eubayanus, lo cual apoya la hipótesis de la migración. Población específica aun no detectada. 10-15 Kb SNPs

16. ¿Es posible hacer cerveza con S. eubayanus? ¿Se puede tomar? Sabor?

17. 1eras Jornadas de Ciencia y Tecnología Cervecera 23-25 noviembres 2013 BARILOCHE, PATAGONIA, ARGENTINA

18. Comentarios Finales y conclusiones - S. eubayanus es el ancestro de la levadura Lager (S. pastorianus). - S. bayanus representa cepas híbridas entre Seub, Suva y Scer. - El análisis de aislamientos adicionales de S. eubayanus muestran alta abundancia y gran diversidad genética. - Las porciones S. eubayanus de los grupos de levaduras Lager son prácticamente idénticas sugeriendo que el ancestro original proviene de una misma población, que aún no ha sido detectada. (AUN SI SE ENCUENTRA EN OTRO LADO: LA PRIMERA FUE ARGENTINA) - A pesar de las limitadas capacidades fermentativas de S. eubayanus cuando comparada con las cepas Lager, es posible que a través de domesticación en el laboratorio, hibridización, etc. se puedan generar cepas interesantes para la industria.

19. Agradecimientos -Hittinger, C. et al. Wisconsin University -Sampaio, J.P. et al. Lisbon University - Fuentes de financiación: UNComahue (Argentina), CONICET (Argentina), ANPCyT (Argentina), Fundacao da Ciencia e Tecnología (Portugal), NIH (USA). Y A USTEDES POR SU ATENCIÓN!! Email: diego.libkind@gmail.com / libkindfd@comahue-conicet.gov.ar

20. 1eras Jornadas de Ciencia y Tecnología Cervecera BARILOCHE, PATAGONIA, ARGENTINA

Add a comment

Related presentations

Cet annuaire illustré a été élaboré lors d'un atelier thématique tenu dans le vill...

Electric Kitchen Chimney top brands like Kaff, faber, ekko, cata, glen, seavy on m...

Paella para 100 personas

Paella para 100 personas

November 8, 2014

paella cien personas

Bri'Ley

Bri'Ley

November 10, 2014

Esta presentación contiene las representaciones de mi pagina web para que el publi...

Candy Bar Rafinat realizat de o echipa de profesionisti - prajiturele delicioase r...

In the Essendon area in Melbourne, restaurants are as diverse as they are many att...

Related pages

Descubriendo el origen de la levadura Lager on Vimeo

This is "Descubriendo el origen de la levadura Lager" by on Vimeo, the home for high quality videos and the people who love them.
Read more

El viaje de las levaduras para crear la cerveza Lager ...

... el origen genético de esta levadura ... a híbridos como la Lager. En los últimos años, el ... descubriendo cepas en el ...
Read more

Fernando on Vimeo

Descubriendo el origen de la levadura Lager . 2 years ago. Entendiendo porque las levaduras hacen lo que hacen . 2 years ago. Levaduras cerveceras . 2 ...
Read more

El viaje de las levaduras para crear la cerveza Lager ...

... el origen genético de esta levadura híbrida ... fortuitamente la levadura Lager es mucho más ... descubriendo cepas en el ...
Read more

Fernando Di Marco - HubSlide

Descubriendo el origen de la levadura lager Descubriendo el origen de la levadura Lager: Implicancias y... 7 months ago © HubSlides 2016. About Us; Help;
Read more

El viaje de las levaduras para crear la cerveza - panamaon.com

... el origen genético de esta levadura híbrida ... fortuitamente la levadura Lager es mucho más ... descubriendo cepas en el ...
Read more

Ciencia: El viaje de las levaduras para crear la cerveza ...

... el origen genético de esta levadura híbrida ... y dan lugar a híbridos como el de la Lager. ... descubriendo cepas en el ...
Read more

El Gourmet Urbano: El viaje de las levaduras para crear la ...

... el origen genético de esta levadura híbrida ... fortuitamente la levadura Lager es mucho más ... descubriendo cepas en el ...
Read more

Manejo de Levaduras Cerveceras - Asociación Civil Somos ...

Origen del proceso Lager, ... S. eubayanus es el progenitor faltante de la levadura Lager ... Descubriendo el progenitor faltante de la levadura Lager
Read more