CFA05

50 %
50 %
Information about CFA05
Science-Technology

Published on August 29, 2007

Author: Mahugani

Source: authorstream.com

Star Formation in Context:  Star Formation in Context Neal Evans University of Texas at Austin Context:  Context Individual star formation in detail Initial conditions and early evolution Formation and evolution of disks Provides the context for planet formation Massive, clustered star formation Details less accessible Statistical results Context for galaxy formation and evolution Low-mass Star Formation:  Low-mass Star Formation R. Hurt, SSC Features: Dusty envelope Rotation Disk Bipolar outflow From Cores to Disks (c2d):  From Cores to Disks (c2d) Science Goals:  Science Goals Complete database for nearby (andlt; 350 pc) regions Low mass star and substar formation Follow evolution: starless cores to planet-forming disks Coordinate with FEPS team ensure complete coverage of 0 to 1 Gyr Cover range of other variables mass, rotation, turbulence, environment, … separate these from evolution. A Typical Starless Core:  A Typical Starless Core L1014 distance ~ 200 pc, but somewhat uncertain. R-band image;dust blocks stars behind and our view of what goes on inside. Forming Star Seen in Infrared:  Forming Star Seen in Infrared Three Color Composite: Blue = 3.6 microns Green = 8.0 microns Red = 24 microns R-band image from DSS at Lower left. We see many stars through the cloud not seen in R. The central source is NOT a background star. L1014 is forming a star (or substar) C. Young et al. ApJS, 154, 396 JHK Image:  JHK Image J, H, K Image of L1014 KPNO 4-m + Flamingos J (19.7) H(20.9) K(19.4) Huard et al. in prep. Preliminary reduction Faint conical nebula to north with apex on IRAC source. BIMA peak to south likely obscures southern lobe. Not a background source. And a VERY small outflow…:  And a VERY small outflow… Lessons from L1014:  Lessons from L1014 'Starless' cores may not be Or may have substellar objects Very low luminosity sources may exist Must be low mass and low accretion Very compact outflow detected with SMA Peculiar, non-thermal radio source Early, small disks are easily detected Md ~ 4 x 10–4 Msun (Rd/50AU)0.5 Easily detected (SNR = 50–100) Rd ~ 50 AU Are there others? About 15 candidates Detailed Studies of Low Mass Star Formation:  Detailed Studies of Low Mass Star Formation Isolation Nearby Good spatial resolution Can study faint features Predictive theories exist n( r), v( r) With caveats, L(t) Allows one to calculate T(r) We need a self-consistent model:  We need a self-consistent model All quantities vary along line of sight Dust temperature, Td( r) Heating from outside, later inside Gas temperature, TK( r) Gas-dust collisions, CRs, PE heating Density, n(r), variations predicted, observed Velocity, v(r), variations predicted, observed Abundance, X(r), variations predicted, observed Photodissociation, freeze-out, desorption Slide13:  An Evolutionary Model:  An Evolutionary Model Assume a slow approach to collapse Sequence of Bonnor-Ebert spheres From nc = 104 to 107 in 6 steps of factors of 3 Total time 1 million years Time step shrinks by factor of 2 for each step in nc Embedded in cloud with AV = 0.5 (or 3) mag Approach a singular isothermal sphere Initiate collapse at t =0 Inside-out collapse (Shu) At each time step, calculate: n (r), v(r), L, Td(r), TK(r), X(r) Chemistry follows gas parcels during collapse The radiation field, density, temperature change as it falls Density and Velocity:  Density and Velocity Set t = 0 at time collapse starts. Assume quasi-static for t andlt; 0, so v = 0. For t andgt; 0, use Shu solution for inside-out collapse. Plan to explore other solutions. Sequence of BE spheres approaches SIS: n(r) ~ r–2 For t andgt; 0, wave of infall moves out at sound speed. Inside rinf, n(r) ~r–1.5 and v(r) ~r–0.5. Theory gives n(r,t), v(r,t):  Theory gives n(r,t), v(r,t) C. Young L(t) from Accretion, Contraction:  L(t) from Accretion, Contraction L(t) calculated. First accretion. First onto large (5 AU) surface (first hydrostatic core). Then onto PMS star with R = 3 Rsun, after 20,000 to 50,000 yr. And onto disk. Prescriptions from Adams and Shu. Contraction luminosity and deuterium burning dominates after t ~100,000 yr. C. Young and Evans, submitted. Dust Radiative Transport:  Dust Radiative Transport C. Young and Evans, submitted Use DUSTY to compute Td( r, t). Include interstellar radiation and central heating from L(t). Compute SED and radial profile from DUSTY and obssphere. Evolution of Dust Tracers:  Evolution of Dust Tracers C. Young and Evans, submitted Assumes distance of 140 pc and typical telescope properties. Calculate Gas Temperature:  Calculate Gas Temperature J. Lee et al. 2004 Use gas energetics code (Doty) with gas-dust collisions, cosmic rays, photoelectric heating, gas cooling. Calculate TK( r, t). A Closer Look:  A Closer Look J. Lee et al. 2004 TK(r) warm on outside due to photoelectric heating. Locked to Td(r) farther in, where density is higher. As BE spheres get denser, both Td(r) and TK(r) get colder at center. For t andgt; 0, central heating, but very low heat until t andgt; 20,000, when FHC collapses to stellar dimensions. Then steady increase in L, warmer on inside. TK at large r depends on AV. Calculate Abundances:  Calculate Abundances J. Lee et al. 2004 Chemical code by E. Bergin 198 time steps of varying length, depending on need. Medium sized network with 80 species, 800 reactions. Follows 512 gas parcels. Includes freeze-out onto grains and desorption due to thermal, CR, photo effects. No reactions on grains. Assume binding energy on silicates for this case. A Closer Look:  A Closer Look J. Lee et al. 2004 A few abundance profiles at t=100,000 yr. Vertical offset for convenience (except CO and HCN). Big effect is CO desorption, which affects most other species. Secondary peaks related to evaporation of other species. Accretion vs. Desorption:  Accretion vs. Desorption J. Lee et al. 2004 Green lines show CO abundance in gas (solid) and ice (dashed) at t = 100,000 yrs. Yellow lines for t = 150,000 yrs. Red dotted line is depletion timescale at t = 100,000 yrs. Blue dotted line is evaporation timescale at t = 100,000 yrs. Wave of desorption moves outward as luminosity rises. Calculate Observables:  Calculate Observables J. Lee et al. In prep Line profiles calculated from Monte Carlo plus virtual telescope codes. Includes collisional excitation, trapping. Variations in density, temperature, abundance, velocity are included. Assumes distance of 140 pc and typical telescope properties. J. Lee et al. 2004 A Closer Look:  A Closer Look J. Lee et al. 2004 Lines of HCO+ (J = 1–0 and 3–2). Shown for four times and for different amounts of extinction in the surrounding medium. Blue profiles are indicative of collapse. Dynamical vs Static Models:  Dynamical vs Static Models J. Lee et al. 2005, in prep. Previous chemical models did not include dynamical evolution. A fully dynamical model captures the changing density and temperature of a gas parcel. Abundances Differ:  Abundances Differ J. Lee et al. 2005, in prep. Solid curve show result of dynamical model; dashed is static model. In particular, the peaks at small radii from direct evaporation of the molecule are missed by static models. Consequences for Line Profiles:  Consequences for Line Profiles J. Lee et al. 2005, in prep. Comparison to Observations:  Comparison to Observations Evans et al. 2005, submitted Observations of B335 Three CS transitions Red line is from chemical model. HCN in B335 and Model:  HCN in B335 and Model Evans et al. 2005, submitted 3D vs 1D Dust Models:  3D vs 1D Dust Models Doty et al. 2005, MNRAS, in press 3D Dust radiative transfer: Allows modeling of shape. Application to L1544. Overall results similar to 1D. Nice constraint on internal luminosity from shape of contours. Summary so far:  Summary so far Beginning to develop evolutionary models Self-consistent physical, chemical models Get a feel for what parameters affect what Starting to explore 3D models Chemistry is crucial to physical modeling Conclusions about dynamics from lines depend on X(r) Surrounding cloud/external radiation important Future work Change dust opacities when ices evaporate Check effect of chemistry on energetics Try other dynamical models Star Formation in Larger Clouds:  Star Formation in Larger Clouds Where do stars form in large molecular clouds? Early evidence indicated only in dense gas Lada et al. 1991: Study of L1630 But surveys were incomplete Need to survey at longer wavelengths Large cloud surveys with c2d and COMPLETE Perseus 12CO Map:  Perseus 12CO Map The COMPLETE Team; Ridge et al.in prep. Perseus 1mm Continuum:  Perseus 1mm Continuum M. Enoch et al., in prep. Perseus 13CO:  Perseus 13CO The COMPLETE Team; Ridge et al.in prep. Perseus MIPS (24+70):  Perseus MIPS (24+70) Stapelfeldt et al. in prep. Perseus Zoom:  Perseus Zoom IRAC1 (blue), IRAC3(green, MIPS1(red) Slide40:  MIPS 24 m Bolocam 1mm Complementary Millimeter andamp; Spitzer IRAC/MIPS Observations: B1 in Perseus Enoch et al. in prep. Dark blue: 24; light blue 70 microns Extinction (2MASS):  Extinction (2MASS) Lessons from Perseus:  Lessons from Perseus There are interesting things going on outside the famous regions Large surveys needed to remove bias A panchromatic view is needed Molecular emission Different molecules show different things Dust continuum emission (across wavelengths) Locations, L, etc. of forming stars Much analysis remains to be done… Disk Evolution:  Disk Evolution Do all solar-mass stars have disks? Do weak-line T Tauri stars have debris disks? Are there variables besides time? What are the timescales for disk evolution? Formation and early evolution during collapse How does the transition from accretion disks to debris disks depend on time and other factors? What is the structure of disks? What is the chemistry in disks? Slide44:  The solid blue line (Total SED A) corresponds to the total SED when the inner rim is irradiated only by the photosphere of the central star (rim A). The solid red line (Total SED B) corresponds to the total SED when the emission from the inner rim is scaled by a factor W. W ranges from ~ 1 to ~7. The inner rim is powered by more than the stellar photosphere Missing source of energy? UV radiation from the accretion shock Evidence for large inner rims in cTTs cgplus model (Dullemond et al. 2001) RrimA~ 0.04 AU RrimA~ 0.07 AU ~ 3.5 Cieza et al. in prep. Finding disks with MIPS:  Finding disks with MIPS Model has 0.1 Mmoon of 30 mm size dust grains in a disk from 30–60 AU Bars are 3 s Model based on disks around A stars A New Disk in Cha II:  A New Disk in Cha II One source not previously identified as a YSO on K vs. K-24 plot Factor of 3 excess in 24 micron flux over stellar model indicating the presence of a disk K.Young et al. in prep. Slide47:  24mm Excesses vs Age decay over ~ 200 Myr - many stars of all ages have no, or very little excess. Slide48:  Robert Hurt, SSC Chemistry in Disks Slide49:  Pontoppidan et al. 2005, ApJ, in press Studies of High Mass Regions:  Studies of High Mass Regions Many Detailed Studies Ho, Zhang, Keto, … Surveys van der Tak et al. (2000) (14 sources) Beuther et al. (2002) (69 sources) Survey of water masers for CS CS survey Plume et al. (1991, 1997) Dense: andlt;log nandgt; = 5.9 Maps of 51 in 350 micron dust emission Mueller et al. 2002 Maps of 63 in CS J = 5–4 emission Shirley et al. 2003 Luminosity versus Mass:  Luminosity versus Mass Mueller et al. (2002) Log Luminosity vs. Log M red line: masses of dense cores from dust Log L = 1.9 + log M blue line: masses of GMCs from CO Log L = 0.6 + log M L/M much higher for dense cores than for whole GMCs. Linewidth versus Size:  Linewidth versus Size Shirley et al. 2003 Correlation is weak. Linewidths are 4-5 times larger than in samples of lower mass cores. Massive clusters form in regions of high turbulence, pressure. Cumulative Mass Function:  Cumulative Mass Function Shirley et al. 2003 Incomplete below 103 Msun. Fit to higher mass bins gives slope of about –0.93. Steeper than that of CO clouds or clumps (–0.5 on this plot). Similar to that of clusters, associations (Massey et al. 1995) in our Galaxy and in Antennae (Fall et al. 2004). Hints of Dynamics:  Hints of Dynamics J. Wu et al. (2003) A significant fraction of the massive core sample show self-reversed, blue-skewed line profiles in lines of HCN 3-2. Of 18 double-peaked profiles, 11 are blue, 3 are red. Suggests inflow motions of overall core. Vin ~ 1 to 4 km/s over radii of 0.3 to 1.5 pc. Low Mass vs. High Mass:  Low Mass vs. High Mass Low Mass star formation 'Isolated' (time to form andlt; time to interact) Low turbulence (less than thermal support) Slow infall Nearby (~ 100 pc) High Mass star formation 'Clustered' Time to form may exceed time to interact Turbulence andgt;andgt; thermal Fast infall? More distant (andgt;400 pc) High vs. Low Early Conditions:  High vs. Low Early Conditions n( r) = nf (r/rf)–p ; rf = 1000 AU Massive Cores: Gross Properties:  Massive Cores: Gross Properties Massive, Dense, Turbulent Mass distribution closer to clusters, stars than GMC Much more turbulent than low mass cores Similar overall power law shape About 100 times denser Linewidths about 16 times wider Star Formation in Galaxies:  Star Formation in Galaxies 'Schmidt Law' Kennicutt Relations SSFR = A SN(gas); N = 1.4 to 2.4 Log S(gas) Log SSFR Kennicutt, 1998, ARAA, 36, 189 Dense gas in galaxies:  Dense gas in galaxies CO detected in many galaxies Increasingly, HCN can be seen in galaxies Star formation rate (LFIR) correlates better with HCN than with CO Slide60:  Gao andamp; Solomon 2004 HCN CO LIR Slide61:  Slide62:  Slide63:  Connecting to Galaxy Evolution:  Connecting to Galaxy Evolution Increasing evidence for rapid formation of some galaxies Detection of many submillimeter galaxies Intense starbursts at z ~2-3 Intense CO, dust, solar metals in QSO at z = 6.4 Are massive dense cores a model for starbursts? L/M much higher than for GMCs as a whole L/Mdust ~ 1.4 x 104 Lsun/Msun ~ high-z starbursts L/L(HCN) similar to starbursts Starburst: all gas like dense cores? Coming Attractions:  Coming Attractions Spitzer 2003 SOFIA 2005 Herschel 2007 JWST 2011 LSAT 2012 SAFIR ~2015 SMA, CARMA, eVLA, LMT, GBT, APEX, ASTE, JCMT, CSO, …

Add a comment

Related presentations

Related pages

CFA | CFA Fights

CFA05; CFA06; CFA07; CFA08; CFA09; CFA10; CFA11; CFA12; CFAFN 01; Tickets; Fights VOD; Videos; Picture Gallery; CFA Girls. ... Championship Fighting ...
Read more

CFA05 - Bout 1 - YouTube

The BankUnited Center presents CFA05, February 24, 2012
Read more

CFA05

CFA05 - 103 1/2 CXF ADAPT ... Customers Who Bought This Item Also Bought
Read more

CFA05 at the BankUnited Center, Chavez v. Parsons Rd 3 ...

Rating is available when the video has been rented. The BankUnited Center presents CFA05 February 24, 2012
Read more

Grégory Cfa05 | LinkedIn

View Grégory Cfa05’s professional profile on LinkedIn. LinkedIn is the world's largest business network, helping professionals like Grégory Cfa05 ...
Read more

Breen 2001: CFA05 - National Institutes of Health

Marker Name Marker Type Repeat/Gene Name Forward Primer Reverse Primer BP-Size Run T PIC; AHTH68Ren: CSM-TGCTTTCTTTGCTTATTCCTATGAT: TGAGAGTCACTCCATTGCTTAGTTT
Read more

Heroics & Ros | CFA05 - JEEPS (x10)

CFA05 - JEEPS (x10) JEEPS (x10) 1/600th model
Read more

Championship Fighting Alliance (“CFA”) l MMA Fights Miami ...

Championship Fighting Alliance, MMA fights, Ring Girls CFA Fight Night Miami CFA Fight Night Miami MMA Event Ring Girls CFA Fight Night Miami MMA Event CFA
Read more

www.gov.uk

www.gov.uk
Read more