20081217 04嘉曉勤 根瘤農桿菌介導敲除紫色紅麴菌桔黴素合成基因

25 %
75 %
Information about 20081217 04嘉曉勤 根瘤農桿菌介導敲除紫色紅麴菌桔黴素合成基因
Health & Medicine

Published on December 24, 2008

Author: Monascus2008

Source: slideshare.net

Description

20081217_04嘉曉勤_根瘤農桿菌介導敲除紫色紅麴菌桔黴素合成基因

Jia Xiaoqin Zhejiang University of Technology 嘉晓勤 浙江工业大学 Agrobacterium tumefaciens -mediated Disruption of Citrinin Synthase Gene in M. purpureus

Targeted Mutagenesis in Eukaryotes 10 -2 More than 1 Kb 70 M ~ 230 M 10 -4 ~ 10 -5 More than 1 Kb, up to 22 kb 70 M ~ 120,000 M 0.5~30% More than 1 kb 30 ~ 40 M 50-100% 50 –100 bp 13.5 M Targeted integration efficiency Homologous DNA-flanking regions Genomic DNA Eukaryote Yeast Filamentous fungus Plant Mammal

1) Protoplasts transformation a. Transformation of protoplasts using electroporation, or by a combination of CaCl 2 and polyethylene glycol (PEG). b. Preparation of intact protoplasts is a tedious process; Regeneration of the protoplasts back to mycelial cultures is very problematic. 2) Biolistic transformation a. Transformation of spores or hyphae by tungsten or gold particles coated with DNA, which are accelerated through high velocity microprojectiles b. The particle bombardment results in integration of DNA sequences as multiple copies. 3) Agrobacterium tumefaciens -mediated transformation (ATMT) a. Transformation of conidia or protoplasts by transferring T-DNA, part of its tumor-inducing (Ti) plasmid, to fungal cells. b. Ease of use, high efficiency and high percentage of single T-DNA insertion Filamentous Fungal Transformation Methodology

IM, bacterial inner membrane; NPC, nuclear pore complex; OM, bacterial outer membrane; PP, bacterial periplasm. A Model for Molecular Interactions during ATMT of Plant Cells

1. Citrinin synthase gene (NCBI: AB167465, pksCT ) pksCT 2. Citrinin synthase (Type I fungal polyketide synthase) Citrinin Synthase in M. purpureus Genomic DNA Gene 1 KS 413 aa AT 294 aa PP 64 aa DREV 157 aa Epimerase 288 aa 2584 aa NAD dependent epimerase/dehydratase family 2213 ... 2500 Epimerase (DH) DREV methyltransferase 1938 ...>2094 DREV (ME) Phosphopantetheine attachment site 1660 ... 1723 PP Acyl transferase domain 906 ... 1199 AT Polyketide synthase (PKS) 383 ... 795 KS Region_name Region Note 5΄ 3΄ 1 9269 1K 2K 3K 4K 5K 6K 7K 8K 9K 7754

Biosynthesis of citrinin

1. Microorganism: M. purpureus SM001 A. tumefacience AGL1 2.Vectors - pDH2857 GPD: D-glyceraldehyde-3-phosphate HPH: Hygromycin B phosphotransferase TRP: Tryptophan - pCAMBIA0380 3.T ransformation & molecular analysis: - Agrobacterium -mediated method - Hygromycin B selection - PCR and Southern blot analysis - Two dimension electrophoresis Materials and Methods T trp hph P mgpd pDH2857 5,572 bp RB LB aadA pCAMBIA0380 6,812 bp

Monascus purpureus spore CM plate 10 6 conidia/ml Co-cultivation Diagram Flow of Transformation Agrobacterium tumefaciens AGL1 YEP medium IM medium IM plate Hygromycin B: 200 μ g/ml Cefotaxime: 200 μ g/ml SM1 agar plate Hygromycin B: 200 μ g/ml SM2 agar plate

Homologous Recombination: (I) Replacement T-DNA Genomic pksCT gene Targeted citrinin gene CTR CTL Pm gpd hph T trp LB RB 1.4kb 0.6kb 2.6kb 5΄ 3΄ 1.4kb 7.15kb 0.6kb 92 1494 8643 9257 5΄ 3΄ 5 6 1.6 kb 5/6 1 2 0.7 kb 1/2 7 8 1.1 kb 7/8

Genomic pksCT gene Insertion type II Genomic pksCT gene Insertion type I T-DNA Homologous Recombination: (II) Insertion 92 1494 8643 9257 5΄ 3΄ 92 1494 8643 9257 5΄ 3΄ LB CTL Pm gpd hph CTR T trp RB CTL T trp Pm gpd hph CTR 3΄ LB RB CTL Pm gpd hph CTR T trp 5΄ 5 6 1.6 kb 5/6 1 2 0.7 kb 1/2 5΄ CTL Pm gpd hph CTR T trp LB RB 3΄ 7 8 1.1 kb 7/8 1 2 0.7 kb 1/2 9 10 1.2 kb 9/10

Results

pL1 Construction of Targeting Vector: (I) pDBJ051 pDH2857 pL1 - digestion 10K bp--- 4K bp--- 2K bp--- 1K bp--- 500 bp--- pDH2857 - digestion Hind III Sal I H + S Hind III Sal I H + S 5΄ 9269 1K 2K 3K 4K 5K 6K 7K 8K 9K 3΄ CTR PCR T trp hph P mgpd pDH2857 5,572 bp T trp hph P mgpd pDBJ051 6,170 bp CTR

10 20 30 40 50 60 70 80 90 100 Citrinin ---TCGACGA CGTTTCCGCG ACACTGGGCG AATTATTGAT TTCTAACACA ACGCCCTATT CGATCTACCA TATCGAGAAT CCGTCAAGGC AACAATGGCG pL1-CITR gag~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 110 120 130 140 150 160 170 180 190 200 Citrinin GAAAATGGTG AAAACGCTGG CCCAGTCACT TGACATCCCA CGAGACGGTA TTATTCCTTT CGATCAATGG ATTGAACGAG TCCGAAATTC CTCGGCCTCA pL1-CITR ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 210 220 230 240 250 260 270 280 290 300 Citrinin ATCAACGACA ACCCGGCCAG GCAATTGCTG GAGTTCTTCG ACCAGCATTT CATCCGAATG TCATGTGGTA ATTTGATACT AGATACGACT AAGACGAGAG pL1-CITR ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 310 320 330 340 350 360 370 380 390 400 Citrinin AGCATTCAGC GACTTTGCGG GAAAGGGGTC CTGTAGGCCC AGGTTTGGTG GAGAAATACA TTTCTGCATG GAAGACCATG GGATTTCTAG ATTAAGAGCG pL1-CITR ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 410 420 430 440 450 460 470 480 490 500 Citrinin TGATGTTAGT TTGGAGTATG TGATGGGTCA GTCACGGTGC TACAATAATG AAAATGTTTT CTTTTTCTTT TTC....TTT TTTTTTTTTT TTTTTTTTTT pL1-CITR ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~ TTTT ~~~ ~~~~~~~~~~ ~~~~~~~~~~ 510 520 530 540 550 560 570 580 590 600 Citrinin TTTCATTTAA TGAAACGATA TAATAATGGT GTTCTAATAA GAACGACATC TGGCTCGGTC AGCCCAGAAA GTACATATTT TTTAATAAAC CAAACAAGTA pL1-CITR ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 610 620 Citrinin ATTTCAGGCT ATTGGAACTC CCA... pL1-CITR ~~~~~~~~~~ ~~~~~~~~~~ ~~~agc Sequence of Inserted Fragment CTR

Construction of Targeting Vector: (II) pDBJ052 pL2 pL1 pL2 - digestion 10K bp--- 4K bp--- 2K bp--- 1K bp--- 500 bp--- pL1 - digestion Sac I Kpn I S + K Sac I Kpn I S + K CTL PCR T trp hph P mgpd pDBJ051 6,170 bp CTR T trp hph P mgpd pDBJ052 7,598 bp CTR CTL 5΄ 9269 1K 2K 3K 4K 5K 6K 7K 8K 9K 3΄

10 20 30 40 50 60 70 80 90 100 Citrinin ---CAACAGT GAGAGCCACC AACATCTATA GATCTGTCAT GGGTTCAGCG CCGATCACAT GCTTCTTACC AACTTCCCTT TTTTCTTCAG CCAGTGCTTT pL2-CITL gct~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 110 120 130 140 150 160 170 180 190 200 Citrinin TGTACTTTCT CTTCTCCAGC GATTCCTTCG TATACATAAG TGCCACCCAA TTGAACAAAG TTGCGTCCAA CCTCTTACAT GATCCAGTAT CCACTTGGCA pL2-CITL ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 210 220 230 240 250 260 270 280 290 300 Citrinin AGTGATTCCT CTTCAAATTC TGAAAGTTTG AGTCCATTTG CAAAAGGAAT TTTGCAGTTG CAGCATGATT GATATGGGGA TTTTCCCATT TTTTAAATCA pL2-CITL ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 310 320 330 340 350 360 370 380 390 400 Citrinin GAAATGGCTA ATAAGACTCG ACCCTCGTGC TCAGCGAGAT TATTTAAAGG TCCATCGCGA ATTGGTGGCA TTATGGCGCG TCGAATTGTA TGGAATCAAT pL2-CITL ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 410 420 430 440 450 460 470 480 490 500 Citrinin ATAGTGGACG TTTTTTCCGA GTATGGTATA TCCGGCGACC ACTATGCACC ATGAATAGAT GCAACCTTAC ACCCTTGTCA GATGCAAGAT TACTCTATAT pL2-CITL ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 510 520 530 540 550 560 570 580 590 600 Citrinin AAGCTGGCAT GCCGATGTGA TTCGCAACCA CTCATTTGAA CTTGGCTAAA GATCGGCAAA CAGTATTCTT GAAGAAAGGA CGTGCGCCGA CACGCATTCT pL2-CITL ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 610 620 630 640 650 660 670 680 690 700 Citrinin GGTCCAAGCT CGTACAGCAG GGTTGGGGAC CGTCCGTACT TCTACACGCT AGCCTACATC TCATCAACGC CTGTTGTTGG AGGCAGAAGC TAGGCGCTGA pL2-CITL ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 710 720 730 740 750 760 770 780 790 800 Citrinin GGTGCAAGCT TTCGGGATTA TTTATCGGAG TAACTTCATC CTTGCGAAGT AAATCCTTCA GGATCTGTAC TTCCGCAGCC CATATCATCT ATGAAGCCCG pL2-CITL ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ Sequence of Inserted Fragment CTL(1)

810 820 830 840 850 860 870 880 890 900 Citrinin TATAGCGGAA GCACAAGCGA GCGGGACGGC TGGCGAATAC CAACATCTGA GAATATCCGA CACAAGCAAG AAGAGTGGGG AGGGGCGCGA GGTAACTGTC pL2-CITL ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 910 920 930 940 950 960 970 980 990 1000 Citrinin CGGAATAATG TTCTGCTGTG GATTTTCAGT TCAGCCTCAC AGGCAGGTGC AGTGGGCACT CCATCAGACT CATATATAGT TGCTACTATC CACGAGATCA pL2-CITL ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 Citrinin GCAAACGGTC TCGCATGGCA GTATATACCG TGTTTGTGTG ATATACCTAC CAGTACCCTA TCATTTTCAA TACGATTTCC CATCGGTCAG CTTCAACGTG pL2-CITL ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 Citrinin ACCAAGGACG GCAGTTTCAA TTGCGGCTAT AAGTTATGAT TGACTCAACT TCGCACTCAA ATCTGAGATC AAAGGCGTTT ATATTCGGCC CGCAGGATTT pL2-CITL ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 Citrinin GTCTTTCGAT GTCAGGTCCT TCAACAAGCT TCACAGCCAG CTCCAAAATC ACCAATGGGT TCTTGATGCG CTCGCCAGCC TGCCAAAGCT TTGGGACAAC pL2-CITL ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 Citrinin TTTGCCGCCA GTGACCAAAA GGTACAGCAA TCCAACACTG GGAAGCTGCT TGAGAACTTG AATGCATGGA TTTCCAGTGG GGTAGCCCCA GAGGAGGCAT pL2-CITL ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 1410 1420 1430 1440 Citrinin TTCCTTTGCC AAATGTGCTT CTTTCCCCGC TCGGTAC--- pL2-CITL ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~cca Sequence of Inserted Fragment CTL(2)

Binary vector Construction of Targeting Vector: (III) pDBJ053 Binary plasmid Agrobacterium CTL hph CTR CTL hph CTR RB LB aadA pCAMBIA0380 6,812 bp T trp hph P mgpd CTR CTL RB aadA LB pDBJ053 11,785 bp T trp hph P mgpd pDBJ052 7,598 bp CTR CTL A. tumefaciens AGL1 A. tumefaciens chromosome Ti plasmid

Effect of AS Concentration & Membrane on ATMT Transformation Efficiency 400 mM 300 mM 200 mM 100 mM 0 mM AS concentration in Pre-cultivation medium 0 mM Acetosyringone (AS) in the IM agar plate 8 9 11 7 0 Cellulose ester membrane 12 9 6 5 0 Nylon membrane 2 0 0 3 0 Filter paper 10 10 14 7 4 Filter paper 7 5 4 4 5 Nylon membrane 18 25 32 41 48 Cellulose ester membrane 200 mM Acetosyringone (AS) in the IM agar plate Number of transformants

Hygromycin Resistant for SM001 & Transformants a: Colony diameter in mm of 5 day cultures, means of three duplicate cultures. 19.3 25 10.0 50 100 12.5 6.25 0 - 19.4 20.4 23.7 M. purpureus SM001 (mm) Colony growth a on CM with hygromycin B at mg/l concentration of 22.0 22.3 22.8 23.0 23.0 23.1 M. purpureus Transformant (mm) 1000 900 800 700 600 500 22.0 200 21.9 300 400 125 100 0 21.9 21.9 22.0 22.0 M. purpureus Transformant (mm) Colony growth a on CM with hygromycin B at mg/l concentration of

PCR Production for Different Types of Transformant 〓 : positive ○: negative ○ ○ ○ 〓 〓 〓 Elsewhere ○ 〓 ○ 〓 〓 〓 Insertion type II 〓 ○ 〓 〓 〓 〓 Insertion type I ○ 〓 〓 ○ 〓 〓 Replacement ○ ○ ○ 〓 ○ 〓 Wild type 9/10 (left I) 7/8 (R-border) 5/6 (L-border) 3/4 (cit) 1/2 ( hph ) a/b (P mgpd 1) Control Replacement Insertion type I Insertion type II Elsewhere a/b 1/2 3/4 5/6 7/8 9/10 a/b 1/2 3/4 5/6 7/8 9/10 a/b 1/2 3/4 5/6 7/8 9/10 a/b 1/2 3/4 5/6 7/8 9/10 a/b 1/2 3/4 5/6 7/8 9/10 0.6 kb 1.6 kb 1.1 kb 0.9 kb 0.7 kb

*Type, Replacement : Insertion type I : Insertion type II : Elsewhere **HR(homologous recombination): Replacement + Insertion type I + Insertion type II ; NHR: Elsewhere PCR Analysis of T-DNA Integration Event (I) 0mM AS in the IM agar plate for co-cultivation 50 : 50 - - 0 : 100 - HR(%) vs. NHR(%) 0 : 0 : 1 : 1 0 0 0 : 0 : 0 : 3 0 Type Filter paper 25 : 75 56 : 44 50 : 50 20 : 80 - HR(%) vs. NHR(%) 1 : 0 : 2 : 9 2 : 0 : 3 : 4 1 : 0 : 2 : 3 1 : 0 : 0 : 4 0 Type Nylon 50 : 50 44 : 56 54 : 36 57 : 43 - HR(%) vs. NHR(%)** 1 : 0 : 3: 4 1 : 1 : 2 : 5 2 : 1 : 4 : 4 1 : 0 : 3 : 3 0 Type * Cellulose ester 400 mM 300 mM 200 mM 100 mM 0 mM AS concentration in A. tumefaciens pre-cultivation medium Membrane filter

(II) 200mM AS in the IM agar plate for co-cultivation *Type, Replacement : Insertion type I : Insertion type II : Elsewhere **HR(homologous recombination): Replacement + Insertion type I + Insertion type II ; NHR: Elsewhere PCR Analysis of T-DNA Integration Event (II) 200mM AS in the IM agar plate for co-cultivation 70 : 30 50 : 50 71 : 29 71 : 29 50 : 50 HR(%) vise NHR(%) 2 : 2 : 3 : 3 4 : 0 : 1 : 5 2 : 1 : 7 :4 2 : 1 : 2 : 2 1 : 0 : 1 : 2 Type Filter paper 43 : 57 40 : 60 50 : 50 50 : 50 60 : 40 HR(%) vise NHR(%) 1 : 0 : 2 : 4 0 : 0 : 2 : 3 0 : 0 : 2 : 2 0 : 0 : 2 : 2 0 : 0 : 3 : 2 Type Nylon 50 : 50 64 : 36 72 : 28 54 : 46 27 : 73 HR(%) vise NHR(%) 5 : 1 : 3 : 9 13 : 0 : 3 : 9 11 : 1 : 11 : 9 7 : 4 : 11 : 19 3 : 1 : 9: 35 Type Cellulose ester 400 mM 300 mM 200 mM 100 mM 0 mM AS concentration in A. tumefaciens pre-cultivation medium Membrane filter

Southern Blot Analysis of Transgenic Fungus CT: parent strain ( M. purpureus SM001) R1, R2, R3: putative gene recombination type I1, I2, I3: putative insertion type I I4, I5, I6: putative insertion type II E1, E2, E3, E4: putative elsewhere insertion type probe CTR CTL Pm gpd hph T trp LB RB T-DNA (kb) 12.0 7.0 6.0 5.0 2.0 1.6 CT R1 R2 R3 I1 I2 I3 I5 I6 I7 E1 E2 E3 E4

Sequence Analysis of Junction of Targeted Event Saccharomyces cerevisiae …… CTATCAGTGTTTGACAGGATATATTGTGGTGTAAACAAATTGACGCTTAGACAACTTAATAACACATTGC …… Sequeence of transformant …… CTATCAGTGTTTGACAGGATATATTGGCGGGTAAACCTAAGAGAAAAGAGCGTTTA RB plasmid TGGCAGGATATATTGTGGTGTAAACAAATTGACGCTTAGACAACTTAATAACACATTGC … LB plasmid fusion 5΄ CTL Pm gpd hph CTR T trp LB RB 3΄ T-DNA LB CTL Pm gpd hph CTR T trp RB CTL T trp Pm gpd hph CTR Junction fragment

10 20 30 40 50 60 70 80 90 100 SEQ tttttttttt tttttttttt CATTTAATGA AACGATATAA TAATGGTGTT CTAATAAGAA CGACATCTGG CTCGGTCAGC CCAGAAAGTA CATATTTTTT CIT ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 110 120 130 140 150 160 170 180 190 200 SEQ CTTAATCGCC TTGCAGCACA TCCCCCTTTC GCCAGAACGC TAGCCACCAC CACCACCACC ACGTGTGAAT TACAGGTGAC CAGCTCGAAT TTCCCCGATC Vector ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~ . .......... .......... .......... .......... .......... .......... T-RB .......... .......... .......... .........~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 210 220 230 240 250 260 270 280 290 300 SEQ GTTCAAACAT TTGGCAATAA AGTTTCTTAA GATTGAATCC TGTTGCCGGT CTTGCGATGA TTATCATATA ATTTCTGTTG AATTACGTTA AGCATGTAAT T-RB ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 310 320 330 340 350 360 370 380 390 400 SEQ AATTAACATG TAATGCATGA CGTTATTTAT GAGATGGGTT TTTATGATTA GAGTCCCGCA ATTATACATT TAATACGCGA TAGAAAACAA AATATAGCGC T-RB ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 410 420 430 440 450 460 470 480 490 500 SEQ GCAAACTAGG ATAAATTATC GCGCGCGGTG TCATCTATGT TACTAGATCG GGAATTAAAC TATCAGTGTT T GACAGGATA TATTGTGGTG TAAACAAATT T-RB ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~ GC ~ G ~ ~~~~~ CT ~ AG T-LB .......... .......... .......... .......... .......... .......... .......... ~~ G ~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 510 520 530 540 550 560 570 580 590 600 SEQ GACGCTTAGA CAACT TAATA ACACATTGCG GACGTTTTTA ATGTACTGAA TTAACGCCGA ATTAATTCCT AGGCCACCAT GTTGGGCCCG GCGCGCCGAA T-RB AGAAAAG ~~ C GTTTA ..... .......... .......... .......... .......... .......... .......... .......... .......... T-LB ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 610 620 630 640 650 660 670 680 690 700 SEQ TTCCCGGGGA TCCGTCGACC TGCAGCCAAG CTTTAAGAGG AGTCCACCAT GGTAGATCTG TCATGGGTTC AGCGCCGATC ACATGCTTCT TACCAAC... T-LB ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~...... .......... .......... .......... .......... CIT .......... .......... .......... .......... .......... ....~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~... Junction Sequence in Transferred DNA

A: M. purpureus SM001 (parent strain) B : Transformant K10 (recombination) C : Transformant A4 (elsewhere insertion) D : Transformant F4 (Insertion type I) E : Transformant C8 (Insertion type II) 2-D Electrophoresis of Proteins from M. purpureus D M pH 10 3 E M pH 10 3 A pH 10 3 M B M pH 10 3 C pH 10 3 M

Matched Comparison of Proteome Image matching by ImageMaster 2D platinum software, version 6.0 B : Transformant K10 (recombination) A: M. purpureus SM001 (parent strain)

HPLC Analysis of SM001 & Mutants Fermented Rice ① Parent strain SM001 Solution ①: standard=3:1 A B Transformant (recombination type) Transformant (Insertion type I) C D Transformant (Insertion type II) Transformant (Elsewhere Insertion) E F

1. Agrobacterium tumefaciens (AGL1-pDBJ053) was used to transform the spore of M. purpureus to disrupt the pksCT gene (citrinin polyketide synthase) by homologous recombination with hygromycin B resistance selection marker. 2. The transformation is effected by acetosyringone concentration and support membrane of the medium. Nitrocellulose membrane showed more efficency than nylon and filters paper in most condition. 3. Different Monascus transformant types have been assessed by conidia PCR. Most gene insertion events utilized the longer region of homology. 4. Southern blot analysis of transformants indicated that those strains had a single-copy hph transgene sequence insertion in the genome. 5. Those transformants retained the hygromycin-resistant phenotype during five vegetative life cycles. Conclusion

Thanks you very much!

Add a comment

Related presentations