2 introduction molecular markers patocchi andrea

63 %
38 %
Information about 2 introduction molecular markers patocchi andrea
Technology

Published on February 28, 2014

Author: fruitbreedomics

Source: slideshare.net

Introduction to molecular markers for breeding of fruit tree species Andrea Patocchi (Agroscope)

Content • What is a molecular marker • Three examples of molecular markers • Examples of applications and limits of molecular markers • Summary

What is a molecular markers? Molecular markers associated to a gene are naturally occurring DNA sequences that are close to the specific genes In general, the DNA sequence of the gene of interest it is not known, while the sequence of the marker associated to it is known gene 1 marker for gene 1 cell chromosome DNA Adapted from: http://biointeraction.blogspot.ch/2010/09/dnaand-chromosome.html

How to find the association … … between a trait and molecular markers? Necessary are: - A good coverage of the genome with molecular markers - A precise phenotyping of the progeny Phenotyping e.g. inoculation with scab of the progeny plants An insufficient coverage with markers leads to weak association scoring and coding ABBAABBBABBBAAAAABB Mistakes during phenotyping lead to wrong associations (map positions) Note: identical score as marker G R-gene Adapted from Collard et al. 2005

Use in breeding Most of the times molecular markers are used to make predictions: Is a specific marker (allele) present, with a determinate probability, is also the gene (allele) of interest present The closer (the more associated) are the molecular marker and the gene of interest, the higher will be the probability of a correct prediction The “perfect” marker is a marker developed within the sequence of the gene The distance of a marker and the gene of interest (or between two markers) is expressed in centimorgan (cM): 1cM = 1 wrong prediction in 100 cases The most used application of markers in breeding is the Marker Assisted Selection (MAS) «perfect» marker for gene 1 Gene 1 Marker 2 for gene 1 Marker 1 for gene 1

Three types of molecular markers Using methods of the molecular biology (polymerase chain reaction; PCR) a DNA fragment is multiplied, and made visible The most used molecular markers in marker assisted selection are: • Sequence Characterized Amplified Regions (SCARs) • Simple Sequence Repeats (SSRs, or microsatellites) • Single Nucleotide Polymorphism (SNP)

Characteristics of the three types of markers SCAR: have in general only two alleles; alleles show presence/absence polymorphism or differs greatly by size Present/absence of a specific band, only one allele is amplified, dominant marker Co-dominant SCAR marker: it allows to distinguish between homo- and heterozygous plants SSR: have often > 10 alleles; the alleles show differences of the length of the repeated sequence (e.g. CTT); allele 1 allele 2 allele 3 …ATGCTTATCGG[CTTCTTCTTCTTCTTCTTCTT]GATCAAATTACCCGTAGATA… …ATGCTTATCGG[CTTCTTCTTCTTCTTCTTCTTCTT]GATCACATTACCCGTAGATA… …ATGCTTATCGG[CTTCTTCTTCTTCTTCTTCTTCTTCTTCTT]GATCACATTACCCGTAGATA… CTT X7 CTT X8 CTT X10 SNP: have in general only two alleles; their sequence differ only by a single nucleotide (null allele also possible) allele 1 allele 2 …ATGCTTATCGGGATCAAATTACCCGTAGATA… …ATGCTTATCGGGATCACATTACCCGTAGATA…

Examples of applications (1) • Allele 159bp of SSR marker CH-Vf1 is associated to Vf • From Florina to F2 26829-2-2 the pedigree is ok BUT • F2 26829-2-2 looks not to be a product of a sib cross (allele 137bp (*) is not present in Mf821 or Rome Beauty) 10 bases ladder Rome Beauty M. floribunda 821 (Vf) F2 26829-2-2 (Vf) Golden Delicious PRI 14-126 (Vf) Starking PRI 612-1 (Vf) Johnatan Florina (Vf) 10 bases ladder Verification of pedigrees Vf allele outbreeder Adapted from Vinatzer et al. 2004

Examples of applications (2) Identification of homozygous genotypes… …in a cross between two genotypes heterozygous for Vf • Allele 159bp of SSR marker CH-Vf1 is associated to Vf • Three progeny plants are outbreeders (probably from the same father) outbreeders Allele 159bp Associated to Vf scab resistance Adapted from Vinatzer et al. 2004

Examples of applications (3) Identification of pyramids of two R-genes (Rvi2&6) …in a cross between two genotypes heterozygous for Rvi2 and Rvi6, respectively Rvi2 rvi2 rvi2/Rvi6 rvi6 rvi2/rvi6 Rvi2/rvi6 M Increasing size of the bands Without molecular markers this work can only be done if virulent isolates to both R-genes are available, BUT is extremely time consuming! Rvi6 Rvi2/Rvi6 P1 P2 S1 S2 S3 S4 S5 Rvi2 marker Rvi6 marker

Examples of applications (4) Early selection for traits that cannot be assessed at seedling stage (fruit traits) e.g. peach: • peach/necatrine phenotype; • yellow/white flesh • Flat/round fruit shape

Examples of applications (5) / Limits Screening of collections … with a marker having an allele highly specific for the allele of the gene of interest (e.g. Rvi6/Vf resistance, SSR CH-Vf1) Caution! The presence of the R-gene (allele) in the genotypes amplifying the allele associated to the R-gene (allele) NEEDS to be validated: • Are the plants really resistant and showing the typical symptoms? • Is it plausible from the pedigree that the genotype is carrying the R-gene? Adapted from Vinatzer et al. 2004

Summary • Molecular markers are very useful tools for breeding • To get efficient and good molecular markers for MAS, we need good phenotyping and good and many markers (2 outputs from FruitBreedomics) • Molecular markers allows to make predictions that cannot be done without them (e.g. pyramids or R-genes,…) • They allows to save money by an early identification of progeny plants having a desired combination of traits

Thank you for your attention

Add a comment

Related presentations

Related pages

Molecular Markers | LinkedIn

Molecular Markers at a glance: 5,378 LinkedIn members have this skill. Where they work. Monsanto Company (40 members) ... Molecular Genetics (344 members)
Read more

resistance to scab, powdery mildew and fire blight Modern ...

... linked molecular markers, mainly SSR’s (Patocchi ... 2: Molecular analysis of the ... based markers linked to the powdery mildew resistance ...
Read more

M Gygax . L Gianfranceschi . R Liebhard . M Kellerhals . C ...

A Patocchi Molecular markers linked to the apple scab resistance ... andrea.patocchi@ipw.agrl.ethz ... Hansen’s #2, all other molecular markers did not.
Read more

Andrea Patocchi - Citations - ResearchGate - Share and ...

... Stefano Tartarini, Andrea Patocchi, Michela Troggio ... Use of molecular markers and flow cytometry to ... derived from ‘Hansen’s baccata #2 ...
Read more

Development of molecular markers linked to the ‘Fiesta ...

Development of molecular markers linked to the ... Cesare Gessler, and Andrea Patocchi ... Introduction Fire blight, the ...
Read more

Isolation of two microsatellite markers from BAC clones of ...

A. Patocchi 2,*, S . Tartarini 3, L ... andrea.patocchi@ipw.agrl ... It was applied to isolate a microsatellite marker from a BAC clone of the chromosomal ...
Read more

Ivonne Molecular 2 - Documents

Share Ivonne Molecular 2. ... 2 introduction molecular markers patocchi andrea ... Introduction To Molecular Medicine Feu (2)
Read more

Marker assisted breeding in apple and peach and Breeders ...

... Marker assisted breeding in apple and ... Introduction on molecular markers ... For what traits do we have markers available. Andrea Patocchi, ...
Read more